Imprinted Gene Databases

Homo sapiens: MEST

Mesoderm specific transcript homolog
Species Gene Aliases Location Status Expressed Allele
Homo sapiens MEST PEG1, MGC8703, MGC111102, DKFZp686L18234  7q32  Imprinted Paternal
Bos taurus MEST PEG1  Imprinted Paternal
Sus scrofa MEST PEG1  18  Imprinted Paternal
Ovis aries MEST PEG1    Imprinted Paternal
Monodelphis domestica MEST PEG1    Imprinted Paternal
Macropus eugenii MEST     Imprinted Paternal
Mus musculus Mest Peg1, AA408879, AI256745  6 7.5 cM  Imprinted Paternal
1      cagcacaccccggcacctcctctgcggcagctgcgcctcgcaagcgcagtgccgcagcgc     60
       ............................................................
61     acgccggagtggctgtagctgcccggcgcggcgccgccctgcgcgggctgtgggctgcgg    120
       ............................................................
121    gctgcgcccccgctgctggccagctctgcacggctgcgggctctgcggcgcccggtgctc    180
       ............................................................
181    tgcaacgctgcggcgggcggcatgggataacgcggccATGGTGCGCCGAGATCGCCTCCG    240
       .....................................M--V--R--R--D--R--L--R-
241    CAGGATGAGGGAGTGGTGGGTCCAGGTGGGGCTGCTGGCCGTGCCCCTGCTTGCTGCGTA    300
       -R--M--R--E--W--W--V--Q--V--G--L--L--A--V--P--L--L--A--A--Y-
301    CCTGCACATCCCACCCCCTCAGCTCTCCCCTGCCCTTCACTCATGGAAGTCTTCAGGCAA    360
       -L--H--I--P--P--P--Q--L--S--P--A--L--H--S--W--K--S--S--G--K-
361    GTTTTTCACTTACAAGGGACTGCGTATCTTCTACCAAGACTCTGTGGGTGTGGTTGGAAG    420
       -F--F--T--Y--K--G--L--R--I--F--Y--Q--D--S--V--G--V--V--G--S-
421    TCCAGAGATAGTTGTGCTTTTACACGGTTTTCCAACATCCAGCTACGACTGGTACAAGAT    480
       -P--E--I--V--V--L--L--H--G--F--P--T--S--S--Y--D--W--Y--K--I-
481    TTGGGAAGGTCTGACCTTGAGGTTTCATCGGGTGATTGCCCTTGATTTCTTAGGCTTTGG    540
       -W--E--G--L--T--L--R--F--H--R--V--I--A--L--D--F--L--G--F--G-
541    CTTCAGTGACAAACCGAGACCACATCACTATTCCATATTTGAGCAGGCCAGCATCGTGGA    600
       -F--S--D--K--P--R--P--H--H--Y--S--I--F--E--Q--A--S--I--V--E-
601    AGCGCTTTTGCGGCATCTGGGGCTCCAGAACCGCAGGATCAACCTTCTTTCTCATGACTA    660
       -A--L--L--R--H--L--G--L--Q--N--R--R--I--N--L--L--S--H--D--Y-
661    TGGAGATATTGTTGCTCAGGAGCTTCTCTACAGGTACAAGCAGAATCGATCTGGTCGGCT    720
       -G--D--I--V--A--Q--E--L--L--Y--R--Y--K--Q--N--R--S--G--R--L-
721    TACCATAAAGAGTCTCTGTCTGTCAAATGGAGGTATCTTTCCTGAGACTCACCGTCCACT    780
       -T--I--K--S--L--C--L--S--N--G--G--I--F--P--E--T--H--R--P--L-
781    CCTTCTCCAAAAGCTACTCAAAGATGGAGGTGTGCTGTCACCCATCCTCACACGACTGAT    840
       -L--L--Q--K--L--L--K--D--G--G--V--L--S--P--I--L--T--R--L--M-
841    GAACTTCTTTGTATTCTCTCGAGGTCTCACCCCAGTCTTTGGGCCGTATACTCGGCCCTC    900
       -N--F--F--V--F--S--R--G--L--T--P--V--F--G--P--Y--T--R--P--S-
901    TGAGAGTGAGCTGTGGGACATGTGGGCAGGGATCCGCAACAATGACGGGAACTTAGTCAT    960
       -E--S--E--L--W--D--M--W--A--G--I--R--N--N--D--G--N--L--V--I-
961    TGACAGTCTCTTACAGTACATCAATCAGAGGAAGAAGTTCAGAAGGCGCTGGGTGGGAGC   1020
       -D--S--L--L--Q--Y--I--N--Q--R--K--K--F--R--R--R--W--V--G--A-
1021   TCTTGCCTCTGTAACTATCCCCATTCATTTTATCTATGGGCCATTGGATCCTGTAAATCC   1080
       -L--A--S--V--T--I--P--I--H--F--I--Y--G--P--L--D--P--V--N--P-
1081   CTATCCAGAGTTTTTGGAGCTGTACAGGAAAACGCTGCCGCGGTCCACAGTGTCGATTCT   1140
       -Y--P--E--F--L--E--L--Y--R--K--T--L--P--R--S--T--V--S--I--L-
1141   GGATGACCACATTAGCCACTATCCACAGCTAGAGGATCCCATGGGCTTCTTGAATGCATA   1200
       -D--D--H--I--S--H--Y--P--Q--L--E--D--P--M--G--F--L--N--A--Y-
1201   TATGGGCTTCATCAACTCCTTCTGAgctggaaagagtagcttccctgtattacctcccct   1260
       -M--G--F--I--N--S--F--***...................................
1261   actcccttatgtgttgtgtattccacttaggaagaaatgcccaaaagaggtcctggccat   1320
       ............................................................
1321   caaacataattctctcacaaagtccactttactcaaattggtgaacagtgtataggaaga   1380
       ............................................................
1381   agccagcaggagctctgactaaggttgacataatagtccacctcccattactttgatatc   1440
       ............................................................
1441   tgatcaaatgtatagacttggctttgttttttgtgctattaggaaattctgatgagcatt   1500
       ............................................................
1501   actattcactgatgcagaaagacgttcttttgcataaaagacttttttttaacactttgg   1560
       ............................................................
1561   acttctctgaaatatttagaagtgctaatttctggcccacccccaacaggaattctatag   1620
       ............................................................
1621   taaggaggaggagaaggggggctccttccctctcctcgaatgacgttatgggcacatgcc   1680
       ............................................................
1681   ttttaaaagttctttaagcaacacagagctgagtcctctttgtcatacctttggatttag   1740
       ............................................................
1741   tgtttcatcagctgtttttagttataaacattttgttaaaatagatattggtttaaatga   1800
       ............................................................
1801   tacagtattttaggtatgatttaagactatgatttacctatacattatatatattttata   1860
       ............................................................
1861   aagatactaaaccagcatacccttactctgccagagtagtgaagctaattaaacacattt   1920
       ............................................................
1921   ggtttctgaataaattgaactaaatccaaactatttcctaaaatcacaggacattaagga   1980
       ............................................................
1981   ccaatagcatctgtgccagagatgtactgttattagctgggaagaccaattctaacagca   2040
       ............................................................
2041   aataacagtctgagactcctcatacctcagtggttagaagcatgtctctcttgagctaca   2100
       ............................................................
2101   gtagaggggaagggattgttgtgtagtcaagtcaccatgctgaatgtacactgattcctt   2160
       ............................................................
2161   tatgatgactgcttaactccccactgcctgtcccagagaggctttccaatgtagctcagt   2220
       ............................................................
2221   aattcctgttactttacagacaggaaagttccagaaactttaagaacaaactctgaaaga   2280
       ............................................................
2281   cctatgagcaaatggtgctgaatactttttttttaaagccacatttcattgtcttagtca   2340
       ............................................................
2341   aagcaggattattaagtgattatttaaaattcgtttttttaaattagcaacttcaagtat   2400
       ............................................................
2401   aacaactttgaaactggaataagtgtttattttctattaataaaaatgaattgtgacaaa   2460
       ............................................................
2461   aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa                2520
       ...............................................