Imprinted Gene Databases

Homo sapiens: MAGEL2

MAGE-like 2
Species Gene Aliases Location Status Expressed Allele
Macaca mulatta MAGEL2   Imprinted Paternal
Mus musculus Magel2 ns7, nM15, NDNL1, Mage-l2  7 28.0 cM  Imprinted Paternal
Homo sapiens MAGEL2 nM15, NDNL1  15q11-q12  Imprinted Paternal
Sus scrofa MAGEL2   Imprinted Paternal
1      agggagggagcctctgaacagccacgtaggcattctcttctctctggaggaaaaggccca     60
       ............................................................
61     gcagctgtccgaggaaaagacccaccagctgtcagcaaagggacATGTCGCAGCTAAGTA    120
       ............................................M--S--Q--L--S--K
121    AGAATCTGGGTGACTCGAGTCCTCCGGCGGAGGCCCCGAAGCCGCCTGTCTATAGCCGCC    180
       --N--L--G--D--S--S--P--P--A--E--A--P--K--P--P--V--Y--S--R--P
181    CTACGGTTCTGATGCGGGCCCCGCCCGCTTCCTCCCGGGCTCCGCCAGTCCCTTGGGATC    240
       --T--V--L--M--R--A--P--P--A--S--S--R--A--P--P--V--P--W--D--P
241    CACCTCCAATTGACTTGCAGGCTTCATTGGCCGCTTGGCAGGCACCTCAGCCTGCCTGGG    300
       --P--P--I--D--L--Q--A--S--L--A--A--W--Q--A--P--Q--P--A--W--E
301    AGGCCCCACAGGGCCAGCTGCCCGCCCCGGTGGTTCCGATGACCCAGCCTCCTGCCCTAG    360
       --A--P--Q--G--Q--L--P--A--P--V--V--P--M--T--Q--P--P--A--L--G
361    GGGGCCCGATAGTCCCGGCTCCCCCGCTGGGGGGCCCGATGGGTAAGCCTCCGACTCCCG    420
       --G--P--I--V--P--A--P--P--L--G--G--P--M--G--K--P--P--T--P--G
421    GGGTCCTGATGGTGCATCCTCCACCTCCGGGAGCCCCGATGGCCCAGCCTCCGACCCCGG    480
       --V--L--M--V--H--P--P--P--P--G--A--P--M--A--Q--P--P--T--P--G
481    GAGTCCTGATGGTGCATCCTTCAGCTCCCGGAGCTCCCATGGCCCATCCTCCTCCTCCGG    540
       --V--L--M--V--H--P--S--A--P--G--A--P--M--A--H--P--P--P--P--G
541    GGACCCCAATGTCCCACCCTCCCCCTCCGGGGACCCCAATGGCCCATCCTCCTCCTCCGG    600
       --T--P--M--S--H--P--P--P--P--G--T--P--M--A--H--P--P--P--P--G
601    GGACCCCGATGGCCCATCCTCCTCCTCCGGGGACCCCGATGGTGCATCCTCCTCCTCCGG    660
       --T--P--M--A--H--P--P--P--P--G--T--P--M--V--H--P--P--P--P--G
661    GGACCCCGATGGCTCATCCTCCCCCTCCGGGGACACCGATGGCTCATCCTCCCCCTCCGG    720
       --T--P--M--A--H--P--P--P--P--G--T--P--M--A--H--P--P--P--P--G
721    GGACACCGATGGCTCATCCTCCACCTCCGGGGACACCGATGGCTCATCCTCCCCCTCCGG    780
       --T--P--M--A--H--P--P--P--P--G--T--P--M--A--H--P--P--P--P--G
781    GTACACCGATGGCCCAGCCTCCAGCTCCGGGAGTCCTGATGGCCCAGCCTCTGACTCCGG    840
       --T--P--M--A--Q--P--P--A--P--G--V--L--M--A--Q--P--L--T--P--G
841    GAGTCCTGATGGTCCAGCCTGCTGCTCCGGGAGCACCGATGGTCCAGCCGCCTCCAGCAG    900
       --V--L--M--V--Q--P--A--A--P--G--A--P--M--V--Q--P--P--P--A--A
901    CCATGATGACCCAGCCTCAGCCTTCAGGAGCACCGATGGCCAAGCCTCCAGGTCCAGGAG    960
       --M--M--T--Q--P--Q--P--S--G--A--P--M--A--K--P--P--G--P--G--V
961    TCCTGATGATTCATCCTCCAGGTGCGAGAGCTCCGATGACCCAGCCTCCAGCTTCAGGAG   1020
       --L--M--I--H--P--P--G--A--R--A--P--M--T--Q--P--P--A--S--G--A
1021   CACCGATGGCACAGCCGGCGGCCCCACCTGCACAGCCGATGGCCCCACCTGCACAGCCGA   1080
       --P--M--A--Q--P--A--A--P--P--A--Q--P--M--A--P--P--A--Q--P--M
1081   TGGCTTCTTGGGCCCCGCAGGCTCAGCCTCTGATCCTGCAAATCCAGTCTCAAGTTATAA   1140
       --A--S--W--A--P--Q--A--Q--P--L--I--L--Q--I--Q--S--Q--V--I--R
1141   GGGCTCCTCCGCAGGTTCCCCAGGGCCCGCAGGCACCCCCAGCGCAGCTAGCCACACCCC   1200
       --A--P--P--Q--V--P--Q--G--P--Q--A--P--P--A--Q--L--A--T--P--P
1201   CGGGCTGGCAGGCGACCTCGCCAGGATGGCAGGCCACGCAGCAAGGCTGGCAGGCCACTC   1260
       --G--W--Q--A--T--S--P--G--W--Q--A--T--Q--Q--G--W--Q--A--T--P
1261   CCCTGACTTGGCAGACCACGCAGGTCACCTGGCAGGCACCAGCCGTTACCTGGCAGGTGC   1320
       --L--T--W--Q--T--T--Q--V--T--W--Q--A--P--A--V--T--W--Q--V--P
1321   CGCCGCCCATGCGCCAGGGGCCCCCGCCCATCCGCCCTGGCCCACCACCCATCCGCCCTG   1380
       --P--P--M--R--Q--G--P--P--P--I--R--P--G--P--P--P--I--R--P--G
1381   GCCCACCACCGGTGCGACAGGCCCCACCGCTGATCCGCCAGGCCCCACCGGTGATCCGCC   1440
       --P--P--P--V--R--Q--A--P--P--L--I--R--Q--A--P--P--V--I--R--Q
1441   AGGCCCCACCCGTGATCCGCCAGGCCCCACCCGTGATCCGCCAGGCCCCCGCTGTGATCC   1500
       --A--P--P--V--I--R--Q--A--P--P--V--I--R--Q--A--P--A--V--I--R
1501   GCCAGGCCCCACCTGTGATCCGCCAGGCCCCACCTGTGATCCGCCAGGCTCCACCTGTGA   1560
       --Q--A--P--P--V--I--R--Q--A--P--P--V--I--R--Q--A--P--P--V--I
1561   TCCGCCAGGCCCCGCCGCTGATCCGCCAGGCGCCGCCGCCCATCCGACCTGCCCCACAGG   1620
       --R--Q--A--P--P--L--I--R--Q--A--P--P--P--I--R--P--A--P--Q--V
1621   TCCTGGCCACCCAGCCACCGCTCTGGCAGGCCCTGCCACCCCCACCTCCACTGCGGCAGG   1680
       --L--A--T--Q--P--P--L--W--Q--A--L--P--P--P--P--P--L--R--Q--A
1681   CCCCGCAGGCTAGGCTGCCGGCCCCGCAGGTGCAGGCGGCGCCGCAGGTGCCTACGGCCC   1740
       --P--Q--A--R--L--P--A--P--Q--V--Q--A--A--P--Q--V--P--T--A--P
1741   CACCTGCTACGCAGGTACCCGCGGCGCCGCCCGCTGGCCCGCAGGTGCCCCAGCCTGTGC   1800
       --P--A--T--Q--V--P--A--A--P--P--A--G--P--Q--V--P--Q--P--V--L
1801   TGCCGGCCCCGCTGTCTGCCCCACTGTCTGCCCCGCAGGCTGTGCACTGCCCTTCCATCA   1860
       --P--A--P--L--S--A--P--L--S--A--P--Q--A--V--H--C--P--S--I--I
1861   TCTGGCAGGCCCCCAAAGGTCAGCCCCCGGTGCCACACGAGATTCCAACGTCAATGGAAT   1920
       --W--Q--A--P--K--G--Q--P--P--V--P--H--E--I--P--T--S--M--E--F
1921   TCCAGGAGGTGCAGCAGACACAGGCGCTGGCCTGGCAGGCCCAGAAGGCCCCCACTCACA   1980
       --Q--E--V--Q--Q--T--Q--A--L--A--W--Q--A--Q--K--A--P--T--H--I
1981   TCTGGCAGCCCCTGCCTGCCCAGGAGGCCCAGAGGCAGGCTCCCCCCTTGGTCCAGCTGG   2040
       --W--Q--P--L--P--A--Q--E--A--Q--R--Q--A--P--P--L--V--Q--L--E
2041   AGCAGCCCTTTCAGGGAGCCCCGCCCTCCCAAAAAGCCGTGCAAATCCAGCTACCCCCCC   2100
       --Q--P--F--Q--G--A--P--P--S--Q--K--A--V--Q--I--Q--L--P--P--Q
2101   AGCAGGCCCAGGCATCGGGTCCGCAAGCGGAGGTGCCCACACTGCCGCTCCAGCCTTCCT   2160
       --Q--A--Q--A--S--G--P--Q--A--E--V--P--T--L--P--L--Q--P--S--W
2161   GGCAGGCACCGCCTGCAGTCTTGCAGGCCCAGCCCGGACCCCCGGTAGCAGCGGCAAATT   2220
       --Q--A--P--P--A--V--L--Q--A--Q--P--G--P--P--V--A--A--A--N--F
2221   TTCCCCTGGGCTCCGCTAAATCATTGATGACTCCATCAGGAGAATGCAGGGCCTCTTCTA   2280
       --P--L--G--S--A--K--S--L--M--T--P--S--G--E--C--R--A--S--S--I
2281   TAGACCGCAGGGGCTCCTCTAAAGAGCGCAGGACCTCCTCGAAGGAGCGCAGGGCCCCTT   2340
       --D--R--R--G--S--S--K--E--R--R--T--S--S--K--E--R--R--A--P--S
2341   CAAAAGACCGCATGATCTTTGCTGCCACCTTCTGTGCTCCCAAGGCAGTGTCAGCTGCGC   2400
       --K--D--R--M--I--F--A--A--T--F--C--A--P--K--A--V--S--A--A--R
2401   GAGCACACCTGCCAGCTGCCTGGAAAAACCTGCCTGCCACACCGGAGACCTTTGCTCCCT   2460
       --A--H--L--P--A--A--W--K--N--L--P--A--T--P--E--T--F--A--P--S
2461   CCTCAAGTGTCTTCCCAGCTACCTCCCAGTTTCAGCCTGCCTCTCTGAATGCCTTTAAAG   2520
       --S--S--V--F--P--A--T--S--Q--F--Q--P--A--S--L--N--A--F--K--G
2521   GCCCCTCTGCTGCCTCAGAGACCCCAAAGTCACTGCCATATGCTCTGCAGGATCCCTTTG   2580
       --P--S--A--A--S--E--T--P--K--S--L--P--Y--A--L--Q--D--P--F--A
2581   CCTGTGTAGAGGCCCTGCCTGCAGTTCCATGGGTCCCACAGCCCAATATGAATGCCTCAA   2640
       --C--V--E--A--L--P--A--V--P--W--V--P--Q--P--N--M--N--A--S--K
2641   AGGCATCGCAGGCAGTGCCCACCTTCCTGATGGCTACAGCAGCTGCCCCCCAGGCAACTG   2700
       --A--S--Q--A--V--P--T--F--L--M--A--T--A--A--A--P--Q--A--T--A
2701   CCACCACTCAAGAGGCCTCCAAGACCTCCGTCGAGCCGCCACGCCGCTCCGGCAAGGCCA   2760
       --T--T--Q--E--A--S--K--T--S--V--E--P--P--R--R--S--G--K--A--T
2761   CCCGGAAGAAGAAGCATCTGGAAGCCCAAGAGGACAGCCGTGGCCACACGCTAGCCTTTC   2820
       --R--K--K--K--H--L--E--A--Q--E--D--S--R--G--H--T--L--A--F--H
2821   ATGACTGGCAGGGCCCAAGGCCCTGGGAGAATCTAAATCTGAGTGACTGGGAGGTCCAAA   2880
       --D--W--Q--G--P--R--P--W--E--N--L--N--L--S--D--W--E--V--Q--S
2881   GCCCTATCCAGGTCTCGGGTGACTGGGAGCACCCAAACACCCCCCGTGGCCTGAGTGGTT   2940
       --P--I--Q--V--S--G--D--W--E--H--P--N--T--P--R--G--L--S--G--W
2941   GGGAGGGCCCTAGCACCTCCAGGATCCTGAGTGGCTGGGAAGGGCCCAGCGCATCCTGGG   3000
       --E--G--P--S--T--S--R--I--L--S--G--W--E--G--P--S--A--S--W--A
3001   CCCTGAGTGCCTGGGAGGGCCCGAGCACCTCCAGGGCCCTGGGTCTCTCTGAAAGCCCAG   3060
       --L--S--A--W--E--G--P--S--T--S--R--A--L--G--L--S--E--S--P--G
3061   GGAGCTCTCTGCCCGTAGTTGTGTCTGAGGTCGCAAGTGTCTCTCCGGGATCCAGTGCCA   3120
       --S--S--L--P--V--V--V--S--E--V--A--S--V--S--P--G--S--S--A--T
3121   CCCAGGATAATTCCAAGGTGGAGGCACAGCCCTTGTCTCCCTTGGATGAGAGGGCAAATG   3180
       --Q--D--N--S--K--V--E--A--Q--P--L--S--P--L--D--E--R--A--N--A
3181   CGTTGGTGCAGTTCCTCTTAGTCAAGGACCAAGCCAAGGTGCCTGTCCAGCGCTCGGAGA   3240
       --L--V--Q--F--L--L--V--K--D--Q--A--K--V--P--V--Q--R--S--E--M
3241   TGGTGAAAGTCATCCTCCGAGAGTATAAAGATGAGTGCTTAGATATCATCAACCGTGCCA   3300
       --V--K--V--I--L--R--E--Y--K--D--E--C--L--D--I--I--N--R--A--N
3301   ACAATAAGCTGGAGTGTGCCTTTGGTTATCAATTGAAAGAAATTGATACCAAAAACCACG   3360
       --N--K--L--E--C--A--F--G--Y--Q--L--K--E--I--D--T--K--N--H--A
3361   CCTATATTATCATCAACAAGCTGGGCTACCATACAGGGAATTTGGTGGCATCCTATTTAG   3420
       --Y--I--I--I--N--K--L--G--Y--H--T--G--N--L--V--A--S--Y--L--D
3421   ACAGGCCCAAGTTTGGCCTTCTGATGGTGGTCTTGAGCCTCATCTTTATGAAAGGCAACT   3480
       --R--P--K--F--G--L--L--M--V--V--L--S--L--I--F--M--K--G--N--C
3481   GTGTCAGGGAGGATCTGATCTTTAATTTTCTGTTCAAGTTAGGGTTGGATGTCCGGGAGA   3540
       --V--R--E--D--L--I--F--N--F--L--F--K--L--G--L--D--V--R--E--T
3541   CAAACGGTCTCTTTGGAAATACTAAGAAGCTCATCACCGAAGTGTTTGTCAGGCAGAAGT   3600
       --N--G--L--F--G--N--T--K--K--L--I--T--E--V--F--V--R--Q--K--Y
3601   ACCTAGAGTACAGGCGAATCCCTTACACTGAGCCCGCAGAGTATGAGTTCCTCTGGGGCC   3660
       --L--E--Y--R--R--I--P--Y--T--E--P--A--E--Y--E--F--L--W--G--P
3661   CTCGAGCATTCCTGGAAACCAGCAAGATGCTTGTCCTGAGGTTTTTGGCCAAGCTCCATA   3720
       --R--A--F--L--E--T--S--K--M--L--V--L--R--F--L--A--K--L--H--K
3721   AGAAAGATCCACAGAGCTGGCCATTCCATTACCTTGAAGCGCTCGCAGAGTGTGAGTGGG   3780
       --K--D--P--Q--S--W--P--F--H--Y--L--E--A--L--A--E--C--E--W--E
3781   AAGACACAGATGAGGATGAACCTGACACCGGTGACAGTGCCCACGGCCCCACCAGCAGGC   3840
       --D--T--D--E--D--E--P--D--T--G--D--S--A--H--G--P--T--S--R--P
3841   CCCCTCCCCGCTAAtaggtgtagcagagatctcgctcctgtgtttccctggccagaggcc   3900
       --P--P--R--***..............................................
3901   actgacagggtggggggacatttttgttcctggtgtttgtgttccagttccacgagtgta   3960
       ............................................................
3961   cgtttggattttcaacttggtttcgtatctgccaaagctttgtacattttttatgtggtg   4020
       ............................................................
4021   ttgatttcaatcggctactgttctgttctgtattttggcatctgtgtttttaagtgagat   4080
       ............................................................
4081   ctgtggttctctgttttgtgttttaattgttatgttttggtatcagctttgtgctggctt   4140
       ............................................................
4141   tgtgaaatgaattgagaagctatccatctcatttctggtatagttcatgtagcattgtaa   4200
       ............................................................
4201   tcggttgttctttgaacgttcaaatgactcatcagtaaaaactgtctacagagaagtaaa   4260
       ............................................................
4261   tatctatatctatatatataaatatactttcagcataa                         4320
       ......................................