Imprinted Gene Databases

Homo sapiens: MAGEL2

MAGE-like 2
Species Gene Aliases Location Status Expressed Allele
Sus scrofa MAGEL2   Imprinted Paternal
Mus musculus Magel2 ns7, nM15, NDNL1, Mage-l2  7 28.0 cM  Imprinted Paternal
Macaca mulatta MAGEL2   Imprinted Paternal
Homo sapiens MAGEL2 nM15, NDNL1  15q11-q12  Imprinted Paternal
1      agggagggagcctctgaacagccacgtaggcattctcttctctctggaggaaaaggccca     60
61     gcagctgtccgaggaaaagacccaccagctgtcagcaaagggacATGTCGCAGCTAAGTA    120
3841   CCCCTCCCCGCTAAtaggtgtagcagagatctcgctcctgtgtttccctggccagaggcc   3900
3901   actgacagggtggggggacatttttgttcctggtgtttgtgttccagttccacgagtgta   3960
3961   cgtttggattttcaacttggtttcgtatctgccaaagctttgtacattttttatgtggtg   4020
4021   ttgatttcaatcggctactgttctgttctgtattttggcatctgtgtttttaagtgagat   4080
4081   ctgtggttctctgttttgtgttttaattgttatgttttggtatcagctttgtgctggctt   4140
4141   tgtgaaatgaattgagaagctatccatctcatttctggtatagttcatgtagcattgtaa   4200
4201   tcggttgttctttgaacgttcaaatgactcatcagtaaaaactgtctacagagaagtaaa   4260
4261   tatctatatctatatatataaatatactttcagcataa                         4320