Imprinted Gene Databases

Homo sapiens: LRRTM1

Leucine rich repeat transmembrane neuronal 1
Species Gene Aliases Location Status Expressed Allele
Homo sapiens LRRTM1   2p12  Imprinted Paternal
1      ttgcgggtcctagaagtcgcctccccgccttgccggccgcccttgcagccccgagccgag     60
       ............................................................
61     cagcaaagtgagacattgtgcgcctgccagatccgccggccgcggaccggggctgcctcg    120
       ............................................................
121    gaaacacagaggggtcttctctcgccctgcatataattagcctgcacacaaagggagcag    180
       ............................................................
181    ctgaatggaggttgtcactctctggaaaaggatttctgaccgagcgcttccaatggacat    240
       ............................................................
241    tctccagtctctctggaaagattctcgctaATGGATTTCCTGCTGCTCGGTCTCTGTCTA    300
       ..............................M--D--F--L--L--L--G--L--C--L--
301    TACTGGCTGCTGAGGAGGCCCTCGGGGGTGGTCTTGTGTCTGCTGGGGGCCTGCTTTCAG    360
       Y--W--L--L--R--R--P--S--G--V--V--L--C--L--L--G--A--C--F--Q--
361    ATGCTGCCCGCCGCCCCCAGCGGGTGCCCGCAGCTGTGCCGGTGCGAGGGGCGGCTGCTG    420
       M--L--P--A--A--P--S--G--C--P--Q--L--C--R--C--E--G--R--L--L--
421    TACTGCGAGGCGCTCAACCTCACCGAGGCGCCCCACAACCTGTCCGGCCTGCTGGGCTTG    480
       Y--C--E--A--L--N--L--T--E--A--P--H--N--L--S--G--L--L--G--L--
481    TCCCTGCGCTACAACAGCCTCTCGGAGCTGCGCGCCGGCCAGTTCACGGGGTTAATGCAG    540
       S--L--R--Y--N--S--L--S--E--L--R--A--G--Q--F--T--G--L--M--Q--
541    CTCACGTGGCTCTATCTGGATCACAATCACATCTGCTCCGTGCAGGGGGACGCCTTTCAG    600
       L--T--W--L--Y--L--D--H--N--H--I--C--S--V--Q--G--D--A--F--Q--
601    AAACTGCGCCGAGTTAAGGAACTCACGCTGAGTTCCAACCAGATCACCCAACTGCCCAAC    660
       K--L--R--R--V--K--E--L--T--L--S--S--N--Q--I--T--Q--L--P--N--
661    ACCACCTTCCGGCCCATGCCCAACCTGCGCAGCGTGGACCTCTCGTACAACAAGCTGCAG    720
       T--T--F--R--P--M--P--N--L--R--S--V--D--L--S--Y--N--K--L--Q--
721    GCGCTCGCGCCCGACCTCTTCCACGGGCTGCGGAAGCTCACCACGCTGCATATGCGGGCC    780
       A--L--A--P--D--L--F--H--G--L--R--K--L--T--T--L--H--M--R--A--
781    AACGCCATCCAGTTTGTGCCCGTGCGCATCTTCCAGGACTGCCGCAGCCTCAAGTTTCTC    840
       N--A--I--Q--F--V--P--V--R--I--F--Q--D--C--R--S--L--K--F--L--
841    GACATCGGATACAATCAGCTCAAGAGTCTGGCGCGCAACTCTTTCGCCGGCTTGTTTAAG    900
       D--I--G--Y--N--Q--L--K--S--L--A--R--N--S--F--A--G--L--F--K--
901    CTCACCGAGCTGCACCTCGAGCACAACGACTTGGTCAAGGTGAACTTCGCCCACTTCCCG    960
       L--T--E--L--H--L--E--H--N--D--L--V--K--V--N--F--A--H--F--P--
961    CGCCTCATCTCCCTGCACTCGCTCTGCCTGCGGAGGAACAAGGTGGCCATTGTGGTCAGC   1020
       R--L--I--S--L--H--S--L--C--L--R--R--N--K--V--A--I--V--V--S--
1021   TCGCTGGACTGGGTTTGGAACCTGGAGAAAATGGACTTGTCGGGCAACGAGATCGAGTAC   1080
       S--L--D--W--V--W--N--L--E--K--M--D--L--S--G--N--E--I--E--Y--
1081   ATGGAGCCCCATGTGTTCGAGACCGTGCCGCACCTGCAGTCCCTGCAGCTGGACTCCAAC   1140
       M--E--P--H--V--F--E--T--V--P--H--L--Q--S--L--Q--L--D--S--N--
1141   CGCCTCACCTACATCGAGCCCCGGATCCTCAACTCTTGGAAGTCCCTGACAAGCATCACC   1200
       R--L--T--Y--I--E--P--R--I--L--N--S--W--K--S--L--T--S--I--T--
1201   CTGGCCGGGAACCTGTGGGATTGCGGGCGCAACGTGTGTGCCCTAGCCTCGTGGCTCAAC   1260
       L--A--G--N--L--W--D--C--G--R--N--V--C--A--L--A--S--W--L--N--
1261   AACTTCCAGGGGCGCTACGATGGCAACTTGCAGTGCGCCAGCCCGGAGTACGCACAGGGC   1320
       N--F--Q--G--R--Y--D--G--N--L--Q--C--A--S--P--E--Y--A--Q--G--
1321   GAGGACGTCCTGGACGCCGTGTACGCCTTCCACCTGTGCGAGGATGGGGCCGAGCCCACC   1380
       E--D--V--L--D--A--V--Y--A--F--H--L--C--E--D--G--A--E--P--T--
1381   AGCGGCCACCTGCTCTCGGCCGTCACCAACCGCAGTGATCTGGGGCCCCCTGCCAGCTCG   1440
       S--G--H--L--L--S--A--V--T--N--R--S--D--L--G--P--P--A--S--S--
1441   GCCACCACGCTCGCGGACGGCGGGGAGGGGCAGCACGACGGCACATTCGAGCCTGCCACC   1500
       A--T--T--L--A--D--G--G--E--G--Q--H--D--G--T--F--E--P--A--T--
1501   GTGGCTCTTCCAGGCGGCGAGCACGCCGAGAACGCCGTGCAGATCCACAAGGTGGTCACG   1560
       V--A--L--P--G--G--E--H--A--E--N--A--V--Q--I--H--K--V--V--T--
1561   GGCACCATGGCCCTCATCTTCTCCTTCCTCATCGTGGTCCTGGTGCTCTACGTGTCCTGG   1620
       G--T--M--A--L--I--F--S--F--L--I--V--V--L--V--L--Y--V--S--W--
1621   AAGTGTTTCCCAGCCAGCCTCAGGCAGCTCAGACAGTGCTTTGTCACGCAGCGCAGGAAG   1680
       K--C--F--P--A--S--L--R--Q--L--R--Q--C--F--V--T--Q--R--R--K--
1681   CAAAAGCAGAAACAGACCATGCATCAGATGGCTGCCATGTCTGCCCAGGAATACTACGTT   1740
       Q--K--Q--K--Q--T--M--H--Q--M--A--A--M--S--A--Q--E--Y--Y--V--
1741   GATTACAAACCGAACCACATTGAGGGAGCCCTGGTGATCATCAACGAGTATGGCTCGTGT   1800
       D--Y--K--P--N--H--I--E--G--A--L--V--I--I--N--E--Y--G--S--C--
1801   ACCTGCCACCAGCAGCCCGCGAGGGAATGCGAGGTGTGAttgtcccagtggctctcaacc   1860
       T--C--H--Q--Q--P--A--R--E--C--E--V--***.....................
1861   catgcgctaccaaatacgcctgggcagccgggacgggccggcgggcaccaggctggggtc   1920
       ............................................................
1921   tccttgtctgtgctctgatatgctccttgactgaaactttaaggggatctctcccagaga   1980
       ............................................................
1981   cttgacattttagctttattgtgtcttaaaaacaaaagcgaattaaaacacaacaaaaaa   2040
       ............................................................
2041   ccccaccccacaaccttcaggacagtctatcttaaatttcatatgagaactccttcctcc   2100
       ............................................................
2101   ctttgaagatctgtccatattcaggaatctgagagtgtaaaaaaggtaccaatcattgat   2160
       ............................................................
2161   tttttttttttttgtaaactaaaatgtttaaaataaaatagcatttacagttaaaaa      2220
       .........................................................