Imprinted Gene Databases

Homo sapiens: L3MBTL

L(3)mbt-like
Species Gene Aliases Location Status Expressed Allele
Monodelphis domestica L3MBTL 1:385894556-385957809:-1  Imprinted Paternal
Mus musculus L3mbtl L3MBTL1, KIAA0681, mKIAA0681, C630004G01  2 H2  Not Imprinted Biallelic
Homo sapiens L3MBTL L3MBTL1, FLJ41181, KIAA0681, H-L(3)MBT, dJ138B7.3, DKFZp586P1522  20q13.12  Imprinted Paternal
1      agagtggggcaccctgggactggaccccgcaggtgcttgggggcgtagcctggagtgagg     60
       ............................................................
61     gtttggctggtgtagcttggagtgaggccccctggcgtggagtcttgaggcctgctgagg    120
       ............................................................
121    gcgtgagctggcATGAGGCGAAGAGAGGGCCATGGCACCGACTCCGAGATGGGTCAAGGA    180
       ............M--R--R--R--E--G--H--G--T--D--S--E--M--G--Q--G--
181    CCCGTACGGGAGTCGCAATCCTCAGACCCTCCCGCGCTCCAGTTCCGGATAAGCGAGTAT    240
       P--V--R--E--S--Q--S--S--D--P--P--A--L--Q--F--R--I--S--E--Y--
241    AAGCCGCTGAACATGGCGGGAGTGGAGCAGCCCCCGAGCCCCGAGCTGCGGCAGGAAGGC    300
       K--P--L--N--M--A--G--V--E--Q--P--P--S--P--E--L--R--Q--E--G--
301    GTGACCGAATACGAAGATGGCGGGGCCCCGGCGGGAGATGGCGAGGCGGGCCCCCAACAG    360
       V--T--E--Y--E--D--G--G--A--P--A--G--D--G--E--A--G--P--Q--Q--
361    GCGGAGGACCACCCCCAGAATCCTCCAGAAGATCCCAATCAGGACCCCCCAGAGGATGAT    420
       A--E--D--H--P--Q--N--P--P--E--D--P--N--Q--D--P--P--E--D--D--
421    AGCACCTGTCAGTGCCAGGCGTGCGGGCCTCACCAAGCCGCGGGTCCAGATCTTGGTTCC    480
       S--T--C--Q--C--Q--A--C--G--P--H--Q--A--A--G--P--D--L--G--S--
481    TCTAATGATGGCTGCCCTCAGCTGTTCCAGGAGCGGTCAGTCATAGTGGAGAACTCCTCA    540
       S--N--D--G--C--P--Q--L--F--Q--E--R--S--V--I--V--E--N--S--S--
541    GGCTCTACCAGCGCTTCTGAGCTCCTCAAACCCATGAAGAAGAGGAAGCGCAGGGAATAC    600
       G--S--T--S--A--S--E--L--L--K--P--M--K--K--R--K--R--R--E--Y--
601    CAGAGCCCATCAGAGGAGGAGTCGGAGCCAGAGGCCATGGAGAAGCAAGAAGAAGGAAAG    660
       Q--S--P--S--E--E--E--S--E--P--E--A--M--E--K--Q--E--E--G--K--
661    GACCCAGAGGGACAACCCACTGCTAGCACCCCAGAGAGTGAGGAGTGGAGCAGCAGCCAG    720
       D--P--E--G--Q--P--T--A--S--T--P--E--S--E--E--W--S--S--S--Q--
721    CCTGCAACAGGTGAGAAGAAGGAATGCTGGTCGTGGGAGTCCTACCTAGAGGAGCAGAAG    780
       P--A--T--G--E--K--K--E--C--W--S--W--E--S--Y--L--E--E--Q--K--
781    GCCATTACTGCTCCAGTCAGCCTCTTCCAGGACTCCCAGGCAGTCACTCACAACAAGAAT    840
       A--I--T--A--P--V--S--L--F--Q--D--S--Q--A--V--T--H--N--K--N--
841    GGCTTCAAACTGGGCATGAAGTTGGAAGGCATTGACCCTCAACACCCGTCCATGTACTTC    900
       G--F--K--L--G--M--K--L--E--G--I--D--P--Q--H--P--S--M--Y--F--
901    ATCCTCACCGTGGCTGAGGTATGTGGCTATCGCCTACGCCTGCACTTTGATGGGTATTCT    960
       I--L--T--V--A--E--V--C--G--Y--R--L--R--L--H--F--D--G--Y--S--
961    GAGTGCCATGACTTCTGGGTCAATGCCAACTCCCCTGACATTCACCCTGCTGGCTGGTTC   1020
       E--C--H--D--F--W--V--N--A--N--S--P--D--I--H--P--A--G--W--F--
1021   GAGAAGACGGGCCACAAGCTGCAGCCTCCCAAAGGTTACAAGGAGGAGGAGTTCAGCTGG   1080
       E--K--T--G--H--K--L--Q--P--P--K--G--Y--K--E--E--E--F--S--W--
1081   AGCCAGTACCTGCGCAGCACAAGAGCTCAGGCTGCCCCCAAGCACCTGTTTGTGAGCCAG   1140
       S--Q--Y--L--R--S--T--R--A--Q--A--A--P--K--H--L--F--V--S--Q--
1141   AGCCACAGTCCCCCACCCCTGGGCTTCCAGGTGGGCATGAAGCTGGAGGCTGTTGACCGC   1200
       S--H--S--P--P--P--L--G--F--Q--V--G--M--K--L--E--A--V--D--R--
1201   ATGAACCCGTCCCTTGTCTGCGTGGCCAGTGTGACCGATGTGGTGGACAGCCGCTTCCTG   1260
       M--N--P--S--L--V--C--V--A--S--V--T--D--V--V--D--S--R--F--L--
1261   GTGCACTTTGACAACTGGGATGATACTTATGACTACTGGTGTGATCCCAGCAGCCCCTAC   1320
       V--H--F--D--N--W--D--D--T--Y--D--Y--W--C--D--P--S--S--P--Y--
1321   ATCCACCCAGTGGGCTGGTGCCAGAAGCAAGGAAAGCCCCTCACCCCTCCACAAGACTAC   1380
       I--H--P--V--G--W--C--Q--K--Q--G--K--P--L--T--P--P--Q--D--Y--
1381   CCAGACCCTGATAACTTCTGTTGGGAGAAATATCTGGAAGAAACTGGGGCCTCTGCTGTC   1440
       P--D--P--D--N--F--C--W--E--K--Y--L--E--E--T--G--A--S--A--V--
1441   CCCACCTGGGCCTTCAAGGTGCGACCCCCTCACAGCTTCCTGGTCAATATGAAGCTGGAG   1500
       P--T--W--A--F--K--V--R--P--P--H--S--F--L--V--N--M--K--L--E--
1501   GCTGTGGACCGCAGGAACCCAGCCCTGATTCGCGTGGCCAGCGTGGAGGATGTGGAGGAC   1560
       A--V--D--R--R--N--P--A--L--I--R--V--A--S--V--E--D--V--E--D--
1561   CATCGGATAAAGATCCACTTTGATGGCTGGAGTCATGGCTATGATTTCTGGATCGACGCT   1620
       H--R--I--K--I--H--F--D--G--W--S--H--G--Y--D--F--W--I--D--A--
1621   GACCACCCAGACATCCACCCTGCCGGCTGGTGCTCCAAGACAGGACATCCCCTGCAGCCT   1680
       D--H--P--D--I--H--P--A--G--W--C--S--K--T--G--H--P--L--Q--P--
1681   CCTCTCGGACCCAGAGAGCCCAGCTCTGCCTCCCCTGGGGGCTGTCCCCCTCTCAGCTAT   1740
       P--L--G--P--R--E--P--S--S--A--S--P--G--G--C--P--P--L--S--Y--
1741   AGGAGCCTGCCCCACACTAGGACCTCCAAATACAGCTTTCACCACCGGAAGTGCCCCACT   1800
       R--S--L--P--H--T--R--T--S--K--Y--S--F--H--H--R--K--C--P--T--
1801   CCTGGTTGCGACGGCTCTGGCCATGTCACAGGCAAGTTCACAGCTCACCATTGCCTCTCA   1860
       P--G--C--D--G--S--G--H--V--T--G--K--F--T--A--H--H--C--L--S--
1861   GGCTGCCCACTGGCTGAGAGGAACCAGAGCCGGCTGAAAGCGGAGCTGTCTGACTCGGAG   1920
       G--C--P--L--A--E--R--N--Q--S--R--L--K--A--E--L--S--D--S--E--
1921   GCCTCAGCCCGCAAGAAGAACCTCTCAGGCTTCTCCCCAAGGAAGAAGCCTCGCCATCAC   1980
       A--S--A--R--K--K--N--L--S--G--F--S--P--R--K--K--P--R--H--H--
1981   GGCCGAATTGGACGCCCTCCGAAGTATCGAAAGATTCCGCAGGAAGATTTCCAGACCCTC   2040
       G--R--I--G--R--P--P--K--Y--R--K--I--P--Q--E--D--F--Q--T--L--
2041   ACGCCCGATGTCGTGCACCAGTCCCTCTTCATGTCAGCCCTGTCGGCCCACCCTGACCGC   2100
       T--P--D--V--V--H--Q--S--L--F--M--S--A--L--S--A--H--P--D--R--
2101   TCACTCTCAGTGTGCTGGGAGCAGCACTGCAAGCTCCTGCCAGGAGTAGCGGGCATCTCA   2160
       S--L--S--V--C--W--E--Q--H--C--K--L--L--P--G--V--A--G--I--S--
2161   GCCTCGACAGTCGCCAAGTGGACCATCGATGAGGTCTTCGGCTTTGTTCAGACCCTGACA   2220
       A--S--T--V--A--K--W--T--I--D--E--V--F--G--F--V--Q--T--L--T--
2221   GGTTGTGAGGACCAAGCACGCCTCTTCAAAGACGAGGCAAGAATAGTCAGAGTGACCCAT   2280
       G--C--E--D--Q--A--R--L--F--K--D--E--A--R--I--V--R--V--T--H--
2281   GTATCTGGGAAGACTCTAGTCTGGACTGTGGCCCAGCTTGGGGACCTTGTGTGCTCAGAT   2340
       V--S--G--K--T--L--V--W--T--V--A--Q--L--G--D--L--V--C--S--D--
2341   CATCTTCAGGAAGGAAAAGGCATCCTGGAGACAGGAGTCCATTCACTCCTCTGCTCTCTA   2400
       H--L--Q--E--G--K--G--I--L--E--T--G--V--H--S--L--L--C--S--L--
2401   CCCACTCATTTGCTTGCCAAACTTAGCTTTGCCAGTGATAGTCAATATTAAagtgtactt   2460
       P--T--H--L--L--A--K--L--S--F--A--S--D--S--Q--Y--***.........
2461   ttttcccctttaatccaatatagttgataattaaagtgtattttgaatgacacagatatt   2520
       ............................................................
2521   gtgatttactgcaaggatcctaacacacacttaaaatcaagagccaaggagtagtgagtt   2580
       ............................................................
2581   gtagataaaaaaagaatgtcagctttggagacagtctgggtttaaatcccagttctgtca   2640
       ............................................................
2641   atttgagctgtttactgtctctgagcctacatcttcttgtctgtaaaatggagataaaat   2700
       ............................................................
2701   gggtttaatgaggtctaccttgcagagccattgtgagcattggaaatgatgaatgaatca   2760
       ............................................................
2761   taccagaacgtctagtataattacagtcatgcattgcttaacgatggggatacattctta   2820
       ............................................................
2821   gaaatgtgtcactaggcaattctgtcattgtgtaaacattatagaatgtacttacacaaa   2880
       ............................................................
2881   cctagatgttatatgtatttttatttacatgtatattttcacatgaaataccaaatgtca   2940
       ............................................................
2941   cagcattattactgaatgtcagtcatttcccctacttgatctgcaatgccaatatcaagg   3000
       ............................................................
3001   gccatgtatcaggtttctgtatatgttccactataatcttatgggaccatggttttaaat   3060
       ............................................................
3061   gtggaatcattgacagaaatgtctttatgtagcatatggctgtgtatcactagtatataa   3120
       ............................................................
3121   tagagcaatattatggaggaatatgtagatccaatcactttacctatacaaaatgactgc   3180
       ............................................................
3181   tatggtgggaacacaataaacaccagttttgacttttaaaaaaaaaaa               3240
       ................................................