Imprinted Gene Databases

Homo sapiens: KLF14

Kruppel-like factor 14
Species Gene Aliases Location Status Expressed Allele
Homo sapiens KLF14 BTEB5  7q32.3  Imprinted Maternal
Mus musculus Klf14 BTEB5, AL022736, 5330411L03Rik  6 A3.3  Imprinted Maternal
1      ATGTCGGCCGCCGTGGCGTGCCTGGACTACTTCGCCGCCGAGTGCCTGGTGTCCATGTCC     60
       M--S--A--A--V--A--C--L--D--Y--F--A--A--E--C--L--V--S--M--S--
61     GCGGGCGCCGTGGTTCACCGCCGCCCGCCGGACCCCGAGGGCGCGGGTGGAGCCGCAGGC    120
       A--G--A--V--V--H--R--R--P--P--D--P--E--G--A--G--G--A--A--G--
121    TCGGAGGTGGGTGCGGCGCATCCGGAGTCCGCTCTGCCGGGTCCGGGGCCATCGGGGCCC    180
       S--E--V--G--A--A--H--P--E--S--A--L--P--G--P--G--P--S--G--P--
181    GCGTCGGTCCCCCAGCTCCCGCAGGTCCCCGCCCCCAGCCCCGGCGCGGGCGGCGCCGCG    240
       A--S--V--P--Q--L--P--Q--V--P--A--P--S--P--G--A--G--G--A--A--
241    CCCCACCTGCTGGCTGCAAGCGTCTGGGCGGACTTGCGCGGCAGCTCTGGCGAGGGCTCC    300
       P--H--L--L--A--A--S--V--W--A--D--L--R--G--S--S--G--E--G--S--
301    TGGGAGAACTCGGGGGAAGCTCCACGCGCCTCGTCCGGCTTCTCCGACCCGATCCCGTGC    360
       W--E--N--S--G--E--A--P--R--A--S--S--G--F--S--D--P--I--P--C--
361    TCCGTCCAGACCCCGTGCTCCGAGCTGGCTCCCGCCTCCGGCGCCGCGGCGGTCTGCGCT    420
       S--V--Q--T--P--C--S--E--L--A--P--A--S--G--A--A--A--V--C--A--
421    CCCGAGAGCTCCTCCGATGCGCCCGCCGTCCCAAGCGCGCCTGCTGCCCCGGGCGCACCA    480
       P--E--S--S--S--D--A--P--A--V--P--S--A--P--A--A--P--G--A--P--
481    GCAGCCTCTGGTGGGTTCTCTGGAGGGGCCCTAGGGGCAGGCCCCGCCCCCGCCGCGGAT    540
       A--A--S--G--G--F--S--G--G--A--L--G--A--G--P--A--P--A--A--D--
541    CAGGCGCCCCGGAGGAGGTCTGTCACACCTGCTGCCAAGCGCCACCAATGCCCCTTCCCG    600
       Q--A--P--R--R--R--S--V--T--P--A--A--K--R--H--Q--C--P--F--P--
601    GGCTGCACCAAAGCCTATTACAAGTCGTCGCACCTCAAGTCCCACCAGCGCACCCACACG    660
       G--C--T--K--A--Y--Y--K--S--S--H--L--K--S--H--Q--R--T--H--T--
661    GGTGAGCGCCCTTTCTCCTGCGACTGGCTCGACTGCGACAAGAAGTTTACGCGTTCCGAC    720
       G--E--R--P--F--S--C--D--W--L--D--C--D--K--K--F--T--R--S--D--
721    GAGCTGGCCCGCCACTACAGGACGCACACGGGCGAGAAGCGCTTCTCCTGCCCCCTCTGC    780
       E--L--A--R--H--Y--R--T--H--T--G--E--K--R--F--S--C--P--L--C--
781    CCCAAGCAGTTCTCCCGGAGCGACCACCTGACCAAGCATGCTCGCCGCCACCCAACCTAT    840
       P--K--Q--F--S--R--S--D--H--L--T--K--H--A--R--R--H--P--T--Y--
841    CATCCAGATATGATCGAGTACCGGGGACGTCGTCGAACTCCCCGCATCGACCCGCCACTC    900
       H--P--D--M--I--E--Y--R--G--R--R--R--T--P--R--I--D--P--P--L--
901    ACCAGCGAGGTGGAAAGCTCCGCCTCCGGCTCCGGTCCCGGCCCGGCGCCCAGCTTCACC    960
       T--S--E--V--E--S--S--A--S--G--S--G--P--G--P--A--P--S--F--T--
961    ACCTGCCTGTAGgacagtcattgctgtcagtcttaccctcaaggatgatcccccaggccg   1020
       T--C--L--***................................................
1021   ttgtccctgctttctctctgcccatccttctttcccagagtcattacaccaaggcacaga   1080
       ............................................................
1081   ctggttcctctgctctgagggtgggtccaggcagacatgtggactctggggaggtactgg   1140
       ............................................................
1141   gggccggaaaatagcgggaattcttgcaacgtgtatatcatcctaaaagtgggggttgcc   1200
       ............................................................
1201   tcaagacagcccccaggaactgataagaagggatgaactcccgtactctccagagtactg   1260
       ............................................................
1261   aagattctcccctccctggaaccagggatgtgaaactggaattctcagatgcctgaggag   1320
       ............................................................
1321   ctcccagtctcaaaggactctggtgtctcacccatccaccaggcggaccttggagagggt   1380
       ............................................................
1381   gtc                                                            1440
       ...