Imprinted Gene Databases

Homo sapiens: KCNQ1

Potassium voltage-gated channel, KQT-like subfamily, member 1
Species Gene Aliases Location Status Expressed Allele
Mus musculus Kcnq1 Kcna9, KVLQT1, AW559127  7 69.3 cM  Imprinted Maternal
Homo sapiens KCNQ1 LQT, RWS, WRS, LQT1, SQT2, ATFB1, ATFB3, JLNS1, KCNA8, KCNA9, Kv1.9, Kv7.1, KVLQT1, FLJ26167  11p15.5  Imprinted Maternal
1      gcggcggggctggcagcagtggctgcccgcactgcgcccgggcgctcgccttcgctgcag     60
       ............................................................
61     ctcccggtgccgccgctcgggccggccccccggcaggccctcctcgttATGGCCGCGGCC    120
       ................................................M--A--A--A--
121    TCCTCCCCGCCCAGGGCCGAGAGGAAGCGCTGGGGTTGGGGCCGCCTGCCAGGCGCCCGG    180
       S--S--P--P--R--A--E--R--K--R--W--G--W--G--R--L--P--G--A--R--
181    CGGGGCAGCGCGGGCCTGGCCAAGAAGTGCCCCTTCTCGCTGGAGCTGGCGGAGGGCGGC    240
       R--G--S--A--G--L--A--K--K--C--P--F--S--L--E--L--A--E--G--G--
241    CCGGCGGGCGGCGCGCTCTACGCGCCCATCGCGCCCGGCGCCCCAGGTCCCGCGCCCCCT    300
       P--A--G--G--A--L--Y--A--P--I--A--P--G--A--P--G--P--A--P--P--
301    GCGTCCCCGGCCGCGCCCGCCGCGCCCCCAGTTGCCTCCGACCTTGGCCCGCGGCCGCCG    360
       A--S--P--A--A--P--A--A--P--P--V--A--S--D--L--G--P--R--P--P--
361    GTGAGCCTAGACCCGCGCGTCTCCATCTACAGCACGCGCCGCCCGGTGTTGGCGCGCACC    420
       V--S--L--D--P--R--V--S--I--Y--S--T--R--R--P--V--L--A--R--T--
421    CACGTCCAGGGCCGCGTCTACAACTTCCTCGAGCGTCCCACCGGCTGGAAATGCTTCGTT    480
       H--V--Q--G--R--V--Y--N--F--L--E--R--P--T--G--W--K--C--F--V--
481    TACCACTTCGCCGTCTTCCTCATCGTCCTGGTCTGCCTCATCTTCAGCGTGCTGTCCACC    540
       Y--H--F--A--V--F--L--I--V--L--V--C--L--I--F--S--V--L--S--T--
541    ATCGAGCAGTATGCCGCCCTGGCCACGGGGACTCTCTTCTGGATGGAGATCGTGCTGGTG    600
       I--E--Q--Y--A--A--L--A--T--G--T--L--F--W--M--E--I--V--L--V--
601    GTGTTCTTCGGGACGGAGTACGTGGTCCGCCTCTGGTCCGCCGGCTGCCGCAGCAAGTAC    660
       V--F--F--G--T--E--Y--V--V--R--L--W--S--A--G--C--R--S--K--Y--
661    GTGGGCCTCTGGGGGCGGCTGCGCTTTGCCCGGAAGCCCATTTCCATCATCGACCTCATC    720
       V--G--L--W--G--R--L--R--F--A--R--K--P--I--S--I--I--D--L--I--
721    GTGGTCGTGGCCTCCATGGTGGTCCTCTGCGTGGGCTCCAAGGGGCAGGTGTTTGCCACG    780
       V--V--V--A--S--M--V--V--L--C--V--G--S--K--G--Q--V--F--A--T--
781    TCGGCCATCAGGGGCATCCGCTTCCTGCAGATCCTGAGGATGCTACACGTCGACCGCCAG    840
       S--A--I--R--G--I--R--F--L--Q--I--L--R--M--L--H--V--D--R--Q--
841    GGAGGCACCTGGAGGCTCCTGGGCTCCGTGGTCTTCATCCACCGCCAGGAGCTGATAACC    900
       G--G--T--W--R--L--L--G--S--V--V--F--I--H--R--Q--E--L--I--T--
901    ACCCTGTACATCGGCTTCCTGGGCCTCATCTTCTCCTCGTACTTTGTGTACCTGGCTGAG    960
       T--L--Y--I--G--F--L--G--L--I--F--S--S--Y--F--V--Y--L--A--E--
961    AAGGACGCGGTGAACGAGTCAGGCCGCGTGGAGTTCGGCAGCTACGCAGATGCGCTGTGG   1020
       K--D--A--V--N--E--S--G--R--V--E--F--G--S--Y--A--D--A--L--W--
1021   TGGGGGGTGGTCACAGTCACCACCATCGGCTATGGGGACAAGGTGCCCCAGACGTGGGTC   1080
       W--G--V--V--T--V--T--T--I--G--Y--G--D--K--V--P--Q--T--W--V--
1081   GGGAAGACCATCGCCTCCTGCTTCTCTGTCTTTGCCATCTCCTTCTTTGCGCTCCCAGCG   1140
       G--K--T--I--A--S--C--F--S--V--F--A--I--S--F--F--A--L--P--A--
1141   GGGATTCTTGGCTCGGGGTTTGCCCTGAAGGTGCAGCAGAAGCAGAGGCAGAAGCACTTC   1200
       G--I--L--G--S--G--F--A--L--K--V--Q--Q--K--Q--R--Q--K--H--F--
1201   AACCGGCAGATCCCGGCGGCAGCCTCACTCATTCAGACCGCATGGAGGTGCTATGCTGCC   1260
       N--R--Q--I--P--A--A--A--S--L--I--Q--T--A--W--R--C--Y--A--A--
1261   GAGAACCCCGACTCCTCCACCTGGAAGATCTACATCCGGAAGGCCCCCCGGAGCCACACT   1320
       E--N--P--D--S--S--T--W--K--I--Y--I--R--K--A--P--R--S--H--T--
1321   CTGCTGTCACCCAGCCCCAAACCCAAGAAGTCTGTGGTGGTAAAGAAAAAAAAGTTCAAG   1380
       L--L--S--P--S--P--K--P--K--K--S--V--V--V--K--K--K--K--F--K--
1381   CTGGACAAAGACAATGGGGTGACTCCTGGAGAGAAGATGCTCACAGTCCCCCATATCACG   1440
       L--D--K--D--N--G--V--T--P--G--E--K--M--L--T--V--P--H--I--T--
1441   TGCGACCCCCCAGAAGAGCGGCGGCTGGACCACTTCTCTGTCGACGGCTATGACAGTTCT   1500
       C--D--P--P--E--E--R--R--L--D--H--F--S--V--D--G--Y--D--S--S--
1501   GTAAGGAAGAGCCCAACACTGCTGGAAGTGAGCATGCCCCATTTCATGAGAACCAACAGC   1560
       V--R--K--S--P--T--L--L--E--V--S--M--P--H--F--M--R--T--N--S--
1561   TTCGCCGAGGACCTGGACCTGGAAGGGGAGACTCTGCTGACACCCATCACCCACATCTCA   1620
       F--A--E--D--L--D--L--E--G--E--T--L--L--T--P--I--T--H--I--S--
1621   CAGCTGCGGGAACACCATCGGGCCACCATTAAGGTCATTCGACGCATGCAGTACTTTGTG   1680
       Q--L--R--E--H--H--R--A--T--I--K--V--I--R--R--M--Q--Y--F--V--
1681   GCCAAGAAGAAATTCCAGCAAGCGCGGAAGCCTTACGATGTGCGGGACGTCATTGAGCAG   1740
       A--K--K--K--F--Q--Q--A--R--K--P--Y--D--V--R--D--V--I--E--Q--
1741   TACTCGCAGGGCCACCTCAACCTCATGGTGCGCATCAAGGAGCTGCAGAGGAGGCTGGAC   1800
       Y--S--Q--G--H--L--N--L--M--V--R--I--K--E--L--Q--R--R--L--D--
1801   CAGTCCATTGGGAAGCCCTCACTGTTCATCTCCGTCTCAGAAAAGAGCAAGGATCGCGGC   1860
       Q--S--I--G--K--P--S--L--F--I--S--V--S--E--K--S--K--D--R--G--
1861   AGCAACACGATCGGCGCCCGCCTGAACCGAGTAGAAGACAAGGTGACGCAGCTGGACCAG   1920
       S--N--T--I--G--A--R--L--N--R--V--E--D--K--V--T--Q--L--D--Q--
1921   AGGCTGGCACTCATCACCGACATGCTTCACCAGCTGCTCTCCTTGCACGGTGGCAGCACC   1980
       R--L--A--L--I--T--D--M--L--H--Q--L--L--S--L--H--G--G--S--T--
1981   CCCGGCAGCGGCGGCCCCCCCAGAGAGGGCGGGGCCCACATCACCCAGCCCTGCGGCAGT   2040
       P--G--S--G--G--P--P--R--E--G--G--A--H--I--T--Q--P--C--G--S--
2041   GGCGGCTCCGTCGACCCTGAGCTCTTCCTGCCCAGCAACACCCTGCCCACCTACGAGCAG   2100
       G--G--S--V--D--P--E--L--F--L--P--S--N--T--L--P--T--Y--E--Q--
2101   CTGACCGTGCCCAGGAGGGGCCCCGATGAGGGGTCCTGAggaggggatggggctggggga   2160
       L--T--V--P--R--R--G--P--D--E--G--S--***.....................
2161   tgggcctgagtgagaggggaggccaagagtggccccacctggccctctctgaaggaggcc   2220
       ............................................................
2221   acctcctaaaaggcccagagagaagagccccactctcagaggccccaataccccatggac   2280
       ............................................................
2281   catgctgtctggcacagcctgcacttgggggctcagcaaggccacctcttcctggccggt   2340
       ............................................................
2341   gtgggggccccgtctcaggtctgagttgttaccccaagcgccctggcccccacatggtga   2400
       ............................................................
2401   tgttgacatcactggcatggtggttgggacccagtggcagggcacagggcctggcccatg   2460
       ............................................................
2461   tatggccaggaagtagcacaggctgagtgcaggcccaccctgcttggcccagggggcttc   2520
       ............................................................
2521   ctgaggggagacagagcaacccctggaccccagcctcaaatccaggaccctgccaggcac   2580
       ............................................................
2581   aggcagggcaggaccagcccacgctgactacagggccgccggcaataaaagcccaggagc   2640
       ............................................................
2641   ccatttggagggcctgggcctggctccctcactctcaggaaatgctgacccatgggcagg   2700
       ............................................................
2701   agactgtggagactgctcctgagcccccagcttccagcaggagggacagtctcaccattt   2760
       ............................................................
2761   ccccagggcacgtggttgagtggggggaacgcccacttccctgggttagactgccagctc   2820
       ............................................................
2821   ttcctagctggagaggagccctgcctctccgcccctgagcccactgtgcgtggggctccc   2880
       ............................................................
2881   gcctccaacccctcgcccagtcccagcagccagccaaacacacagaaggggactgccacc   2940
       ............................................................
2941   tccccttgccagctgctgagccgcagagaagtgacggttcctacacaggacaggggttcc   3000
       ............................................................
3001   ttctgggcattacatcgcatagaaatcaataatttgtggtgatttggatctgtgttttaa   3060
       ............................................................
3061   tgagtttcacagtgtgattttgattattaattgtgcaagcttttcctaataaacgtggag   3120
       ............................................................
3121   aatcacaggctgggctgggcactgctctcaccttggttcctggggcatccatggggtctc   3180
       ............................................................
3181   tcacagacaggacccctgcagttcccctggaagcagtgcccaggtggctgtggaatagga   3240
       ............................................................
3241   acgctaaaaaaaaaaaaaaaaa                                         3300
       ......................