Imprinted Gene Databases

Homo sapiens: INS

Insulin
Species Gene Aliases Location Status Expressed Allele
Mus musculus Ins2 Mody, Ins-2, Mody4, AA986540, proinsulin, INS  7 69.1 cM  Imprinted Paternal
Homo sapiens INS ILPR, IRDN  11p15.5  Imprinted Paternal
Macropus eugenii INS     Imprinted Paternal
1      agccctccaggacaggctgcatcagaagaggccatcaagcagatcactgtccttctgccA     60
       ...........................................................M
61     TGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACC    120
       --A--L--W--M--R--L--L--P--L--L--A--L--L--A--L--W--G--P--D--P
121    CAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACC    180
       --A--A--A--F--V--N--Q--H--L--C--G--S--H--L--V--E--A--L--Y--L
181    TAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACC    240
       --V--C--G--E--R--G--F--F--Y--T--P--K--T--R--R--E--A--E--D--L
241    TGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGG    300
       --Q--V--G--Q--V--E--L--G--G--G--P--G--A--G--S--L--Q--P--L--A
301    CCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCT    360
       --L--E--G--S--L--Q--K--R--G--I--V--E--Q--C--C--T--S--I--C--S
361    CCCTCTACCAGCTGGAGAACTACTGCAACTAGacgcagcccgcaggcagccccacacccg    420
       --L--Y--Q--L--E--N--Y--C--N--***............................
421    ccgcctcctgcaccgagagagatggaataaagcccttgaaccagcaaaa               480
       .................................................