Imprinted Gene Databases

Homo sapiens: IMPACT

Impact homolog
Species Gene Aliases Location Status Expressed Allele
Homo sapiens IMPACT MGC33718  18q11.2-q12.1  Not Imprinted Biallelic
Oryctolagus cuniculus IMPACT   Imprinted Paternal
Monodelphis domestica IMPACT     Not Imprinted Biallelic
Rattus norvegicus Impact   18  Imprinted Paternal
Mus musculus Impact E430016J11Rik  18 A2-B2  Imprinted Paternal
1      gtggttccgggtcgggccgcgccgcagccagctctcggctcgcagccgcagcgccccgcc     60
61     cccgcgctccggacctggcaggcggcggctgcagggcaggtccaggggccacATGGCTGA    120
1081   gaaactataggaaaggttaatttgcctataattatatatacattccatagtcatcaagga   1140
1141   atatattgtgcagagagagtatccttgactgcttaagtcagccagttcagcatggatacc   1200
1201   aacattagcttttcttcttggttatatcatctgccaaaaatagagaacttatgatctatt   1260
1261   catgtgtgtttcaggcttatttgggagaactaatttgaacttaatcaccacttcatctaa   1320
1321   ttttagcaaggtaacagttgcccagggcagtacctgaattaactgtccatttcagtacat   1380
1381   gtcaagtgcctttgttaggtggagaagaaatgtctctagaggaatataaatacctgattt   1440
1441   cttgtcatcgagattcttgtactgttaaatgaatattgccttttactgctctttatggct   1500
1501   tattggaataggagctcatttaagattgatcttggagagtttcttcttgtgattttagtt   1560
1561   cataagtatgtcacctttcattttatagtgttcatcattgagtaatggattaagtgaaaa   1620
1621   tccaggagtatccatctgcagttatgtgctgaggtgataattcatccaacatatttgtta   1680
1681   gcataaatattatgcttcagtttctgttgcaaattggtgattgtgaaattacagaaagtg   1740
1741   attttctagtctgctttttttgtttaattcttgtaatgtaagcaataaatatggagtgtc   1800
1801   agtagtctccttccaccccagaaatgtgttggtgtaacattctcgtttcttttaacaacc   1860
1861   tggaagtacctttcttgtgatcttcactgaggaattagaactatgatagaagttaggctg   1920
1921   tggcaaatgggacattcgtagagtgggatagaggtggcagaatgaacctggtgtagggca   1980
1981   ggagtatgttgtgtagttacatcaatttgatgcatgctttccatctgcactccagacggc   2040
2041   tttctcagttccaagattttgcagagagaaggagcaaaccttttcattggaaaaacagaa   2100
2101   acaaccctcccccccattttttcccctctattcatcaaacctttatgtatctttcatctt   2160
2161   ccagttacctctaggcatttagatagtgaaatttacctttgagatataacaataagtgat   2220
2221   taactgttcactttcagatgtaatggcaaacaattgttaaaagttattaactgatcacag   2280
2281   atttgcctggacttcccttcccagggagggaacagaagttaggaggcaactttgggatgg   2340
2341   tgctagagcatggaaagcacagagaattggacaaacaggtctttttctcttttctctgat   2400
2401   gttttacctttaaaagatccaacatccttaccgttggtatttttagtaaggttatagtaa   2460
2461   atagctttacaccaggatggattctgaaatataaattctaaattatatttgttataacta   2520
2521   tattttatgttgtatgttatcaggagccatcagagaatgacctttttgtgtttggaacac   2580
2581   ttggttccatgaaaagtatgctttgtgttttaactgttaaaataatttaaaaattaatta   2640
2641   ttttacataattaaagaagttaaaaactattaacattaaataatttcacaatttcaacat   2700
2701   gtcaaacctatgaagggagataggaaacaatgagaaacttacttttgctcctttatacag   2760
2761   aattattaactatattttactaactaaaaaactctagtattctttacctaaagtcaattg   2820
2821   gctggtaagagggagagatgcaaaattctccagctctgaacttggagctacttcacactc   2880
2881   tactcttaatggaaacttgaactaatgatagatagtatttttttcctctatttaaaattt   2940
2941   ttgtcttgattaggagatttttcagttctccatataataattttctacaatcagatctat   3000
3001   gctgtggcatattttgctttatttaaaaatttttttttagagatgagttcttgctctgtc   3060
3061   acctaggctggagtgcagtggcatgatcatggctcactgcagccttgaccttccagcctg   3120
3121   ccaagtagctgggattacagacaggcatgtgctattacacctggctaatttttaaagttt   3180
3181   tttttgtaaagatagggtctttctatgttgcccaggctcgtcttgagctcctggcctcaa   3240
3241   tcgatcttcctgccaaggttttggaattacaggtgtgagccaccatgcctggcctgcttt   3300
3301   gacatattttatagtgtgttaattacaaatagtcttcatatgccagaatataagagcaag   3360
3361   tgttatctactttttagatgggaattgcagaagctgcatcaaaagtatgctttgaggtat   3420
3421   atatagtgaaacagagcctttctgaagagaattatatcaaactaattacaaccaagaaat   3480
3481   aatagtatgaagcggatgctgtttggaggacaggaaaatttatcgggaaaattacataat   3540
3541   ccctctgattccactatccagagatagccattattattaatatttggtatgtacatcctt   3600
3601   atattatttttttcttatgcatgattttgtatatatggttatttttctttccataaaaat   3660
3661   ggtattaaactgtatatactgttttgtagcctacatatttcatatagaagtatattgtta   3720
3721   acattttccatgtcaataaatattcttctatggcttaaaaaaaa                   3780