Imprinted Gene Databases

Homo sapiens: HTR2A

5-hydroxytryptamine receptor 2A
Species Gene Aliases Location Status Expressed Allele
Monodelphis domestica HTR2A     Imprinted Maternal
Bos taurus HTR2A 5HT2A, 5HTR2A  12  Not Imprinted Biallelic
Mus musculus Htr2a Htr2, Htr-2, MGC124301, MGC124302, E030013E04  14 41.5 cM  Imprinted Maternal
Homo sapiens HTR2A HTR2, 5-HT2A  13q14-q21  Conflicting Data Maternal
1      gtggaaaccaggagtcccttggtgcagacagctcttcctactttcccatgcagttctttt     60
       ............................................................
61     gtgcgactttgaggggctcgtgaatgatttctaaatgtgtgcctgctgaggcgagccgca    120
       ............................................................
121    cagggagggaggaacccagccgagccgtgccagaggaagccaacaggatcctagcagtgc    180
       ............................................................
181    gggagctggctcagctcttgcatgcagtttttgaagtcagcaaaacagaaaccaaattac    240
       ............................................................
241    tatcatattatgctggtggaagatcaagaagaggggactctacaccagtttaattactgt    300
       ............................................................
301    gagagatgcagcgagtcacagaataacaaatgtatctcatgtgtggaccctgaagacaaa    360
       ............................................................
361    tgacatttatcttcccgagcgctcaaaaaaaaccctgcaacctctatgctaaaagttcat    420
       ............................................................
421    tctgcttttttgtcctcggtttggtgagaaaataataaaaccaaacagtggactctccta    480
       ............................................................
481    aaattgtgaatgaagaaaacttacagccaccacagttcagttctttaactatcattgtaa    540
       ............................................................
541    taatggaagacaaaaatccagccccgggagaacagcatgtacaccagcctcagtgttaca    600
       ............................................................
601    gagtgtgggtacatcaaggtgaatggtgagcagaaactataacctgttagtccttctaca    660
       ............................................................
661    cctcatctgctacaagttctggcttagacATGGATATTCTTTGTGAAGAAAATACTTCTT    720
       .............................M--D--I--L--C--E--E--N--T--S--L
721    TGAGCTCAACTACGAACTCCCTAATGCAATTAAATGATGACACCAGGCTCTACAGTAATG    780
       --S--S--T--T--N--S--L--M--Q--L--N--D--D--T--R--L--Y--S--N--D
781    ACTTTAACTCCGGAGAAGCTAACACTTCTGATGCATTTAACTGGACAGTCGACTCTGAAA    840
       --F--N--S--G--E--A--N--T--S--D--A--F--N--W--T--V--D--S--E--N
841    ATCGAACCAACCTTTCCTGTGAAGGGTGCCTCTCACCGTCGTGTCTCTCCTTACTTCATC    900
       --R--T--N--L--S--C--E--G--C--L--S--P--S--C--L--S--L--L--H--L
901    TCCAGGAAAAAAACTGGTCTGCTTTACTGACAGCCGTAGTGATTATTCTAACTATTGCTG    960
       --Q--E--K--N--W--S--A--L--L--T--A--V--V--I--I--L--T--I--A--G
961    GAAACATACTCGTCATCATGGCAGTGTCCCTAGAGAAAAAGCTGCAGAATGCCACCAACT   1020
       --N--I--L--V--I--M--A--V--S--L--E--K--K--L--Q--N--A--T--N--Y
1021   ATTTCCTGATGTCACTTGCCATAGCTGATATGCTGCTGGGTTTCCTTGTCATGCCCGTGT   1080
       --F--L--M--S--L--A--I--A--D--M--L--L--G--F--L--V--M--P--V--S
1081   CCATGTTAACCATCCTGTATGGGTACCGGTGGCCTCTGCCGAGCAAGCTTTGTGCAGTCT   1140
       --M--L--T--I--L--Y--G--Y--R--W--P--L--P--S--K--L--C--A--V--W
1141   GGATTTACCTGGACGTGCTCTTCTCCACGGCCTCCATCATGCACCTCTGCGCCATCTCGC   1200
       --I--Y--L--D--V--L--F--S--T--A--S--I--M--H--L--C--A--I--S--L
1201   TGGACCGCTACGTCGCCATCCAGAATCCCATCCACCACAGCCGCTTCAACTCCAGAACTA   1260
       --D--R--Y--V--A--I--Q--N--P--I--H--H--S--R--F--N--S--R--T--K
1261   AGGCATTTCTGAAAATCATTGCTGTTTGGACCATATCAGTAGGTATATCCATGCCAATAC   1320
       --A--F--L--K--I--I--A--V--W--T--I--S--V--G--I--S--M--P--I--P
1321   CAGTCTTTGGGCTACAGGACGATTCGAAGGTCTTTAAGGAGGGGAGTTGCTTACTCGCCG   1380
       --V--F--G--L--Q--D--D--S--K--V--F--K--E--G--S--C--L--L--A--D
1381   ATGATAACTTTGTCCTGATCGGCTCTTTTGTGTCATTTTTCATTCCCTTAACCATCATGG   1440
       --D--N--F--V--L--I--G--S--F--V--S--F--F--I--P--L--T--I--M--V
1441   TGATCACCTACTTTCTAACTATCAAGTCACTCCAGAAAGAAGCTACTTTGTGTGTAAGTG   1500
       --I--T--Y--F--L--T--I--K--S--L--Q--K--E--A--T--L--C--V--S--D
1501   ATCTTGGCACACGGGCCAAATTAGCTTCTTTCAGCTTCCTCCCTCAGAGTTCTTTGTCTT   1560
       --L--G--T--R--A--K--L--A--S--F--S--F--L--P--Q--S--S--L--S--S
1561   CAGAAAAGCTCTTCCAGCGGTCGATCCATAGGGAGCCAGGGTCCTACACAGGCAGGAGGA   1620
       --E--K--L--F--Q--R--S--I--H--R--E--P--G--S--Y--T--G--R--R--T
1621   CTATGCAGTCCATCAGCAATGAGCAAAAGGCATGCAAGGTGCTGGGCATCGTCTTCTTCC   1680
       --M--Q--S--I--S--N--E--Q--K--A--C--K--V--L--G--I--V--F--F--L
1681   TGTTTGTGGTGATGTGGTGCCCTTTCTTCATCACAAACATCATGGCCGTCATCTGCAAAG   1740
       --F--V--V--M--W--C--P--F--F--I--T--N--I--M--A--V--I--C--K--E
1741   AGTCCTGCAATGAGGATGTCATTGGGGCCCTGCTCAATGTGTTTGTTTGGATCGGTTATC   1800
       --S--C--N--E--D--V--I--G--A--L--L--N--V--F--V--W--I--G--Y--L
1801   TCTCTTCAGCAGTCAACCCACTAGTCTACACACTGTTCAACAAGACCTATAGGTCAGCCT   1860
       --S--S--A--V--N--P--L--V--Y--T--L--F--N--K--T--Y--R--S--A--F
1861   TTTCACGGTATATTCAGTGTCAGTACAAGGAAAACAAAAAACCATTGCAGTTAATTTTAG   1920
       --S--R--Y--I--Q--C--Q--Y--K--E--N--K--K--P--L--Q--L--I--L--V
1921   TGAACACAATACCGGCTTTGGCCTACAAGTCTAGCCAACTTCAAATGGGACAAAAAAAGA   1980
       --N--T--I--P--A--L--A--Y--K--S--S--Q--L--Q--M--G--Q--K--K--N
1981   ATTCAAAGCAAGATGCCAAGACAACAGATAATGACTGCTCAATGGTTGCTCTAGGAAAGC   2040
       --S--K--Q--D--A--K--T--T--D--N--D--C--S--M--V--A--L--G--K--Q
2041   AGCATTCTGAAGAGGCTTCTAAAGACAATAGCGACGGAGTGAATGAAAAGGTGAGCTGTG   2100
       --H--S--E--E--A--S--K--D--N--S--D--G--V--N--E--K--V--S--C--V
2101   TGTGAtaggctagttgccgtggcaactgtggaaggcacactgagcaagttttcacctatc   2160
       --***.......................................................
2161   tggaaaaaaaaaaatatgagattggaaaaaattagacaagtctagtggaaccaacgatca   2220
       ............................................................
2221   tatctgtatgcctcattttattctgtcaatgaaaagcggggttcaatgctacaaaatgtg   2280
       ............................................................
2281   tgcttggaaaatgttctgacagcatttcagctgtgagctttctgatacttatttataaca   2340
       ............................................................
2341   ttgtaaatgatatgtctttaaaatgattcacttttattgtataattatgaagccctaagt   2400
       ............................................................
2401   aaatctaaattaacttctattttcaagtggaaaccttgctgctatgctgttcattgatga   2460
       ............................................................
2461   catgggattgagttggttacctattgctgtaaataaaaatagctataaatagtgaaaatt   2520
       ............................................................
2521   ttattgaatataatggcctcttaaaaattatctttaaaacttactatggtatatattttg   2580
       ............................................................
2581   aaaggagaaaaaaaaagccactaaggtcagtgttataaaatctgtattgctaagataatt   2640
       ............................................................
2641   aaatgaaatacttgacaacatttttcattcctgctttttcatagataccattttgaaata   2700
       ............................................................
2701   ttcacaaggttgctggcatttgctgcatttcaagttaattctcagaagtgaaaaagactt   2760
       ............................................................
2761   caaatgttattcaataactattgctgctttctcttctacttcttgtgctttactctgaat   2820
       ............................................................
2821   ttccagtgtggtcttgtttaatatttgttcctctaggtaaactagcaaaaggatgattta   2880
       ............................................................
2881   acattaccaaatgcctttctagcaattgcttctctaaaacagcactatcgaggtatttgg   2940
       ............................................................
2941   taacttgctgtgaaatgactgcatcatgcatgcactcttttgagcagtaaatgtatattg   3000
       ............................................................
3001   atgtaactgtgtcaggattgaggatgaactcaggtttccggctactgacagtggtagagt   3060
       ............................................................
3061   cctaggacatctctgtaaaaagcaggtgactttcctatgacactcatcaggtaaactgat   3120
       ............................................................
3121   gctttcagatccatcggtttatactatttattaaaaccattctgcttggttccacaatca   3180
       ............................................................
3181   tctattgagtgtacatttatgtgtgaagcaaatttctagatatgagaaatataaaaataa   3240
       ............................................................
3241   ttaaaacaaaatccttgccttcaaacgaaatggctcggccaggcacggaggctcgtgcat   3300
       ............................................................
3301   gtaatcctagcactttgggaggctgagatgggaggatcacttgaggccaagagtttgaga   3360
       ............................................................
3361   ccaacctgggtaacaaagtgagacctccctgtctctacaaaaaaaatcaaaaaattatct   3420
       ............................................................
3421   gatccttgtggcacacaactgtggtcccagctacaggggaggctgagacgcaaggatcac   3480
       ............................................................
3481   ttgagcccagaagctcaaggctgcagtgagccaagttcacaccactgccatttcctcctg   3540
       ............................................................
3541   ggcaacagagtgagaccctatcac                                       3600
       ........................