Imprinted Gene Databases

Homo sapiens: HOXA4

Homeobox A4

Luedi et al. Genome Res. 17: , 2007 PDF; Luedi et al. Genome Res. 17: , 2007 Supplement

Species Gene Aliases Location Status Expressed Allele
Homo sapiens HOXA4 HOX1, HOX1D  7p15-p14  Predicted Maternal
1      aaaacgacaacgcgagaaaaattagtatttttgcacttcacaaattaATGACCATGAGCT     60
       ...............................................M--T--M--S--S
61     CGTTTTTGATAAACTCCAACTACATCGAGCCCAAGTTCCCTCCCTTCGAGGAGTACGCGC    120
       --F--L--I--N--S--N--Y--I--E--P--K--F--P--P--F--E--E--Y--A--Q
121    AGCACAGCGGCTCGGGCGGCGCAGACGGCGGCCCGGGCGGGGGCCCCGGCTACCAGCAGC    180
       --H--S--G--S--G--G--A--D--G--G--P--G--G--G--P--G--Y--Q--Q--P
181    CCCCAGCGCCCCCGACCCAGCACCTGCCGCTGCAGCAGCCCCAGCTCCCTCACGCGGGCG    240
       --P--A--P--P--T--Q--H--L--P--L--Q--Q--P--Q--L--P--H--A--G--G
241    GCGGCCGAGAGCCCACTGCCTCCTACTACGCGCCGCGGACCGCCCGCGAGCCCGCCTACC    300
       --G--R--E--P--T--A--S--Y--Y--A--P--R--T--A--R--E--P--A--Y--P
301    CTGCTGCCGCGCTGTACCCCGCGCATGGGGCCGCGGACACCGCCTACCCCTATGGCTACC    360
       --A--A--A--L--Y--P--A--H--G--A--A--D--T--A--Y--P--Y--G--Y--R
361    GCGGCGGCGCCAGCCCCGGGCGGCCGCCCCAGCCCGAGCAGCCCCCGGCGCAAGCCAAGG    420
       --G--G--A--S--P--G--R--P--P--Q--P--E--Q--P--P--A--Q--A--K--G
421    GCCCAGCGCACGGCCTGCATGCGAGCCACGTCCTGCAGCCCCAGCTGCCGCCGCCCCTGC    480
       --P--A--H--G--L--H--A--S--H--V--L--Q--P--Q--L--P--P--P--L--Q
481    AGCCTCGCGCCGTGCCCCCAGCGGCCCCGCGGCGCTGCGAGGCGGCCCCCGCCACCCCAG    540
       --P--R--A--V--P--P--A--A--P--R--R--C--E--A--A--P--A--T--P--G
541    GCGTCCCGGCAGGGGGCAGCGCCCCCGCGTGCCCGCTGCTCTTGGCCGACAAGAGCCCGC    600
       --V--P--A--G--G--S--A--P--A--C--P--L--L--L--A--D--K--S--P--L
601    TGGGCCTGAAGGGCAAGGAGCCCGTGGTGTACCCCTGGATGAAGAAGATCCATGTCAGCG    660
       --G--L--K--G--K--E--P--V--V--Y--P--W--M--K--K--I--H--V--S--A
661    CCGTTAACCCCAGTTATAACGGAGGGGAGCCTAAGCGCTCTCGAACCGCCTACACCCGGC    720
       --V--N--P--S--Y--N--G--G--E--P--K--R--S--R--T--A--Y--T--R--Q
721    AGCAGGTCTTGGAGCTGGAGAAGGAGTTCCACTTCAATCGATACCTGACCCGGCGGCGCC    780
       --Q--V--L--E--L--E--K--E--F--H--F--N--R--Y--L--T--R--R--R--R
781    GCATCGAGATCGCCCACACGCTCTGTTTGTCTGAGCGCCAGGTCAAGATCTGGTTTCAGA    840
       --I--E--I--A--H--T--L--C--L--S--E--R--Q--V--K--I--W--F--Q--N
841    ACCGGAGGATGAAGTGGAAGAAAGACCACAAACTGCCCAACACCAAGATGCGATCCTCCA    900
       --R--R--M--K--W--K--K--D--H--K--L--P--N--T--K--M--R--S--S--N
901    ATTCGGCCTCGGCCTCTGCCGGCCCACCAGGGAAAGCACAAACTCAGAGCCCACACCTCC    960
       --S--A--S--A--S--A--G--P--P--G--K--A--Q--T--Q--S--P--H--L--H
961    ATCCCCACCCCCACCCGAGCACCTCCACACCCGTTCCCTCCTCCATATAAtcttctagag   1020
       --P--H--P--H--P--S--T--S--T--P--V--P--S--S--I--***..........
1021   atcttaaccagtttctatcccttacctgcttttctcttctcttctcctgctccgttcctc   1080
       ............................................................
1081   atccacccctccccatctggaccataatagacaccaaaacaaacccaaattggtgaaaag   1140
       ............................................................
1141   aataatcaaaaagaagacattatccggttaagagtctgtgctggttgccacccaagagag   1200
       ............................................................
1201   aacagttgtccaggatgctggctggtggaacaacctgctggcccgaaacaaggctgccag   1260
       ............................................................
1261   gtgtggatacctgagaaggactacttggtatcaaatacttttgagatggctacagtcagc   1320
       ............................................................
1321   tagctggacagcccatgctgagtggggacatacacttgcatctttgttgaaagcagaaga   1380
       ............................................................
1381   agacagaccctttccccaccttccttacctcctcttcccccattaaggcagctcatccaa   1440
       ............................................................
1441   gcttgtatttaactgaataaatgagtagacattgtggacctcacaagattatttaattct   1500
       ............................................................
1501   taagatgtgtagaccttgatggtaggtgtgacatgttagtttttcttacttgcatttatt   1560
       ............................................................
1561   taagacactgttacagagatactgttgtccccttctggggcacggtctttggggagaggg   1620
       ............................................................
1621   gagtgcatttagacttatgtggaactgtacaaattgtgatgtggctacatagaaagccat   1680
       ............................................................
1681   gtgctaagaataaactccatttaaaaaacattaaaaatctaagattca               1740
       ................................................