Imprinted Gene Databases

Homo sapiens: HM13

Histocompatibility 13
Species Gene Aliases Location Status Expressed Allele
Homo sapiens HM13 H13, SPP, IMP1, PSL3, IMPAS, SPPL1, PSENL3, IMPAS-1, MSTP086, dJ324O17.1  20q11.21  Unknown Unknown
Mus musculus H13 Spp, H-13, Hm13, PSL3, AV020344, 1200006O09Rik, 4930443L17Rik, 5031424B04Rik  2 86.0 cM  Imprinted Maternal
Sus scrofa H13 HM13  17  Not Imprinted Biallelic
1      cgtcacttcctgttgccttaggggaacgtggctttccctgcagagccggtgtctccgcct     60
       ............................................................
61     gcgtccctgctgcagcaaccggagctggagtcggatcccgaacgcaccctcgccATGGAC    120
       ......................................................M--D--
121    TCGGCCCTCAGCGATCCGCATAACGGCAGTGCCGAGGCAGGCGGCCCCACCAACAGCACT    180
       S--A--L--S--D--P--H--N--G--S--A--E--A--G--G--P--T--N--S--T--
181    ACGCGGCCGCCTTCCACGCCCGAGGGCATCGCGCTGGCCTACGGCAGCCTCCTGCTCATG    240
       T--R--P--P--S--T--P--E--G--I--A--L--A--Y--G--S--L--L--L--M--
241    GCGCTGCTGCCCATCTTCTTCGGCGCCCTGCGCTCCGTACGCTGCGCCCGCGGCAAGAAT    300
       A--L--L--P--I--F--F--G--A--L--R--S--V--R--C--A--R--G--K--N--
301    GCTTCAGACATGCCTGAAACAATCACCAGCCGGGATGCCGCCCGCTTCCCCATCATCGCC    360
       A--S--D--M--P--E--T--I--T--S--R--D--A--A--R--F--P--I--I--A--
361    AGCTGCACACTCTTGGGGCTCTACCTCTTTTTCAAAATATTCTCCCAGGAGTACATCAAC    420
       S--C--T--L--L--G--L--Y--L--F--F--K--I--F--S--Q--E--Y--I--N--
421    CTCCTGCTGTCCATGTATTTCTTCGTGCTGGGAATCCTGGCCCTGTCCCACACCATCAGC    480
       L--L--L--S--M--Y--F--F--V--L--G--I--L--A--L--S--H--T--I--S--
481    CCCTTCATGAATAAGTTTTTTCCAGCCAGCTTTCCAAATCGACAGTACCAGCTGCTCTTC    540
       P--F--M--N--K--F--F--P--A--S--F--P--N--R--Q--Y--Q--L--L--F--
541    ACACAGGGTTCTGGGGAAAACAAGGAAGAGATCATCAATTATGAATTTGACACCAAGGAC    600
       T--Q--G--S--G--E--N--K--E--E--I--I--N--Y--E--F--D--T--K--D--
601    CTGGTGTGCCTGGGCCTGAGCAGCATCGTTGGCGTCTGGTACCTGCTGAGGAAGCACTGG    660
       L--V--C--L--G--L--S--S--I--V--G--V--W--Y--L--L--R--K--H--W--
661    ATTGCCAACAACCTTTTTGGCCTGGCCTTCTCCCTTAATGGAGTAGAGCTCCTGCACCTC    720
       I--A--N--N--L--F--G--L--A--F--S--L--N--G--V--E--L--L--H--L--
721    AACAATGTCAGCACTGGCTGCATCCTGCTGGGCGGACTCTTCATCTACGATGTCTTCTGG    780
       N--N--V--S--T--G--C--I--L--L--G--G--L--F--I--Y--D--V--F--W--
781    GTATTTGGCACCAATGTGATGGTGACAGTGGCCAAGTCCTTCGAGGCACCAATAAAATTG    840
       V--F--G--T--N--V--M--V--T--V--A--K--S--F--E--A--P--I--K--L--
841    GTGTTTCCCCAGGATCTGCTGGAGAAAGGCCTCGAAGCAAACAACTTTGCCATGCTGGGA    900
       V--F--P--Q--D--L--L--E--K--G--L--E--A--N--N--F--A--M--L--G--
901    CTTGGAGATGTCGTCATTCCAGGGATCTTCATTGCCTTGCTGCTGCGCTTTGACATCAGC    960
       L--G--D--V--V--I--P--G--I--F--I--A--L--L--L--R--F--D--I--S--
961    TTGAAGAAGAATACCCACACCTACTTCTACACCAGCTTTGCAGCCTACATCTTCGGCCTG   1020
       L--K--K--N--T--H--T--Y--F--Y--T--S--F--A--A--Y--I--F--G--L--
1021   GGCCTTACCATCTTCATCATGCACATCTTCAAGCATGCTCAGCCTGCCCTCCTATACCTG   1080
       G--L--T--I--F--I--M--H--I--F--K--H--A--Q--P--A--L--L--Y--L--
1081   GTCCCCGCCTGCATCGGTTTTCCTGTCCTGGTGGCGCTGGCCAAGGGAGAAGTGACAGAG   1140
       V--P--A--C--I--G--F--P--V--L--V--A--L--A--K--G--E--V--T--E--
1141   ATGTTCAGTTATGAGGAGTCAAATCCTAAGGATCCAGCGGCAGTGACAGAATCCAAAGAG   1200
       M--F--S--Y--E--E--S--N--P--K--D--P--A--A--V--T--E--S--K--E--
1201   GGAACAGAGGCATCAGCATCGAAGGGGCTGGAGAAGAAAGAGAAATGAtgcagctggtgc   1260
       G--T--E--A--S--A--S--K--G--L--E--K--K--E--K--***............
1261   ccgagcctctcagggccagaccagacagatgggggctgggcccacacaggcgtgcaccgg   1320
       ............................................................
1321   tagagggcacaggaggccaagggcagctccaggacagggcagggggcagcaggatacctc   1380
       ............................................................
1381   cagccaggcctctgtggcctctgtttccttctccctttcttggccctcctctgctcctcc   1440
       ............................................................
1441   ccacaccctgcaggcaaaagaaacccccagcttcccccctccccgggagccaggtgggaa   1500
       ............................................................
1501   aagtgggtgtgatttttagattttgtattgtggactgattttgcctcacattaaaaactc   1560
       ............................................................
1561   atcccatggccagggcgggccactgtgctcctggaaaaaaaaaa                   1620
       ............................................