Imprinted Gene Databases

Homo sapiens: GRB10

Growth factor receptor-bound protein 10

Blagitko et al. Hum Mol Gene 9: 1587-1595, 2000

Species Gene Aliases Location Status Expressed Allele
Macropus eugenii GRB10     Not Imprinted Biallelic
Ovis aries GRB10     Imprinted Maternal
Homo sapiens GRB10 RSS, IRBP, MEG1, GRB-IR, Grb-10, KIAA0207  7p12-p11.2  Imprinted Isoform Dependent
Mus musculus Grb10 Meg1, AI325020, mKIAA0207, 5730571D09Rik  11 8.0 cM  Imprinted Isoform Dependent
1      aaatgtaatttgaagaaggcagaaggaacccATGGCTTTAGCCGGCTGCCCAGATTCCTT     60
       ...............................M--A--L--A--G--C--P--D--S--F-
61     TTTGCACCATCCGTACTACCAGGACAAGGTGGAGCAGACACCTCGCAGTCAACAAGACCC    120
       -L--H--H--P--Y--Y--Q--D--K--V--E--Q--T--P--R--S--Q--Q--D--P-
121    GGCAGGACCAGGACTCCCCGCACAGTCTGACCGACTTGCGAATCACCAGGAGGATGATGT    180
       -A--G--P--G--L--P--A--Q--S--D--R--L--A--N--H--Q--E--D--D--V-
181    GGACCTGGAAGCCCTGGTGAACGATATGAATGCATCCCTGGAGAGCCTGTACTCGGCCTG    240
       -D--L--E--A--L--V--N--D--M--N--A--S--L--E--S--L--Y--S--A--C-
241    CAGCATGCAGTCAGACACGGTGCCCCTCCTGCAGAATGGCCAGCATGCCCGCAGCCAGCC    300
       -S--M--Q--S--D--T--V--P--L--L--Q--N--G--Q--H--A--R--S--Q--P-
301    TCGGGCTTCAGGCCCTCCTCGGTCCATCCAGCCACAGGTGTCCCCGAGGCAGAGGGTGCA    360
       -R--A--S--G--P--P--R--S--I--Q--P--Q--V--S--P--R--Q--R--V--Q-
361    GCGCTCCCAGCCTGTGCACATCCTCGCTGTCAGGCGCCTTCAGGAGGAAGACCAGCAGTT    420
       -R--S--Q--P--V--H--I--L--A--V--R--R--L--Q--E--E--D--Q--Q--F-
421    TAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGCCCTGGGAG    480
       -R--T--S--S--L--P--A--I--P--N--P--F--P--E--L--C--G--P--G--S-
481    CCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAGCAGGATGT    540
       -P--P--V--L--T--P--G--S--L--P--P--S--Q--A--A--A--K--Q--D--V-
541    TAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAGCAGACATGACAGC    600
       -K--V--F--S--E--D--G--T--S--K--V--V--E--I--L--A--D--M--T--A-
601    CAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGATGACAACAGCTGGAC    660
       -R--D--L--C--Q--L--L--V--Y--K--S--H--C--V--D--D--N--S--W--T-
661    ACTAGTGGAGCACCACCCGCACCTAGGATTAGAGAGGTGCTTGGAAGACCATGAGCTGGT    720
       -L--V--E--H--H--P--H--L--G--L--E--R--C--L--E--D--H--E--L--V-
721    GGTCCAGGTGGAGAGTACCATGGCCAGTGAGAGTAAATTTCTATTCAGGAAGAATTACGC    780
       -V--Q--V--E--S--T--M--A--S--E--S--K--F--L--F--R--K--N--Y--A-
781    AAAATACGAGTTCTTTAAAAATCCCATGAATTTCTTCCCAGAACAGATGGTTACTTGGTG    840
       -K--Y--E--F--F--K--N--P--M--N--F--F--P--E--Q--M--V--T--W--C-
841    CCAGCAGTCAAATGGCAGTCAAACCCAGCTTTTGCAGAATTTTCTGAACTCCAGTAGTTG    900
       -Q--Q--S--N--G--S--Q--T--Q--L--L--Q--N--F--L--N--S--S--S--C-
901    TCCTGAAATTCAAGGGTTTTTGCATGTGAAAGAGCTGGGAAAGAAATCATGGAAAAAGCT    960
       -P--E--I--Q--G--F--L--H--V--K--E--L--G--K--K--S--W--K--K--L-
961    GTATGTGTGTTTGCGGAGATCTGGCCTTTATTGCTCCACCAAGGGAACTTCAAAGGAACC   1020
       -Y--V--C--L--R--R--S--G--L--Y--C--S--T--K--G--T--S--K--E--P-
1021   CAGACACCTGCAGCTGCTGGCCGACCTGGAGGACAGCAACATCTTCTCCCTGATCGCTGG   1080
       -R--H--L--Q--L--L--A--D--L--E--D--S--N--I--F--S--L--I--A--G-
1081   CAGGAAGCAGTACAACGCCCCTACAGACCACGGGCTCTGCATAAAGCCAAACAAAGTCAG   1140
       -R--K--Q--Y--N--A--P--T--D--H--G--L--C--I--K--P--N--K--V--R-
1141   GAATGAAACTAAAGAGCTGAGGTTGCTCTGTGCAGAGGACGAGCAAACCAGGACGTGCTG   1200
       -N--E--T--K--E--L--R--L--L--C--A--E--D--E--Q--T--R--T--C--W-
1201   GATGACAGCGTTCAGACTCCTCAAGTATGGAATGCTCCTTTACCAGAATTACCGAATCCC   1260
       -M--T--A--F--R--L--L--K--Y--G--M--L--L--Y--Q--N--Y--R--I--P-
1261   TCAGCAGAGGAAGGCCTTGCTGTCCCCGTTCTCGACGCCAGTGCGCAGTGTCTCCGAGAA   1320
       -Q--Q--R--K--A--L--L--S--P--F--S--T--P--V--R--S--V--S--E--N-
1321   CTCCCTCGTGGCAATGGATTTTTCTGGGCAAACAGGACGCGTGATAGAGAATCCGGCGGA   1380
       -S--L--V--A--M--D--F--S--G--Q--T--G--R--V--I--E--N--P--A--E-
1381   GGCCCAGAGCGCAGCCCTGGAGGAGGGCCACGCCTGGAGGAAGCGAAGCACACGGATGAA   1440
       -A--Q--S--A--A--L--E--E--G--H--A--W--R--K--R--S--T--R--M--N-
1441   CATCCTAGGTAGCCAAAGTCCCCTCCACCCTTCTACCCTAAGTACAGTGATTCACAGGAC   1500
       -I--L--G--S--Q--S--P--L--H--P--S--T--L--S--T--V--I--H--R--T-
1501   ACAGCACTGGTTTCACGGGAGGATCTCCAGGGAGGAATCCCACAGGATCATTAAACAGCA   1560
       -Q--H--W--F--H--G--R--I--S--R--E--E--S--H--R--I--I--K--Q--Q-
1561   AGGGCTCGTGGATGGGCTTTTTCTCCTCCGTGACAGCCAGAGTAATCCAAAGGCATTTGT   1620
       -G--L--V--D--G--L--F--L--L--R--D--S--Q--S--N--P--K--A--F--V-
1621   ACTCACACTGTGTCATCACCAGAAAATTAAAAATTTCCAGATCTTACCTTGCGAGGACGA   1680
       -L--T--L--C--H--H--Q--K--I--K--N--F--Q--I--L--P--C--E--D--D-
1681   CGGGCAGACGTTCTTCAGCCTAGATGACGGGAACACCAAATTCTCTGACCTGATCCAGCT   1740
       -G--Q--T--F--F--S--L--D--D--G--N--T--K--F--S--D--L--I--Q--L-
1741   GGTTGACTTTTACCAGCTGAACAAAGGAGTCCTGCCTTGCAAACTCAAGCACCACTGCAT   1800
       -V--D--F--Y--Q--L--N--K--G--V--L--P--C--K--L--K--H--H--C--I-
1801   CCGAGTGGCCTTATGAccgcagatgtcctctcggctgaagactggaggaagtgaacactg   1860
       -R--V--A--L--***............................................
1861   gagtgaagaagcggtctgtgcgttggtgaagaacacacatcgattctgcacctggggacc   1920
       ............................................................
1921   cagagcgagatgggtttgttcggtgccagccgaccaagattgactagtttgttggactta   1980
       ............................................................
1981   aacgacgatttgctgctgtgaacccagcagggtcgcctccctctgcgtcggccaaattgg   2040
       ............................................................
2041   ggagggcatggaagatccagcggaaagttgaaaataaactggaatgatcatcttggcttg   2100
       ............................................................
2101   ggccgcttaggaacaagaaccggagagaagtgattggaaatgaactcttgccctggaata   2160
       ............................................................
2161   atcttgacaattaaaactgatatgtttactttttttgtattgatcacttttttgcactcc   2220
       ............................................................
2221   ttctttgttttcaatattgtattcagcctattgtaggagggggatgtggcgtttcaactc   2280
       ............................................................
2281   atataatacagaaagagttttgaatgggcagatttcaaactgaatatgggtccccaaatg   2340
       ............................................................
2341   ttcccagagggtcctccacaccctctgccgactaccacggtgtggattcagctcccaaat   2400
       ............................................................
2401   gacaaacccagcccttcccagtatacttgaaaagctttcttgttaaaataaaaggtgtca   2460
       ............................................................
2461   ctgtggtaggcatttggcatattttgtggactcagtcaagcaaccacagtctgttaatca   2520
       ............................................................
2521   tttctctatgctcagatgtcagatcctcttgttattagtgtgtcttgttctgcacagtgc   2580
       ............................................................
2581   aggagactttattcctttggaaaattcactgttccacaaacagcaggctgaatggcctcg   2640
       ............................................................
2641   cctctagattgacgtgggccagcctccttgagacacacctggcacccgtcatcggccagc   2700
       ............................................................
2701   ggtggatgctgcataatccacctgggtacttcagccttgcgtttccacagccttcagcct   2760
       ............................................................
2761   gttctagaacgatcactgccttacccctgctgctgcagtggtgtgagtcgtttcacggct   2820
       ............................................................
2821   gatgtccctcgggggattaaaggatctaaagagaaaatggcacctggttgtcttcgtgct   2880
       ............................................................
2881   gtgtctcatgggtttccatagtgataaagacaaggaaacgctgcaggggccacaggcaca   2940
       ............................................................
2941   ggctgatatttaaagatctttgcttgcagccctccgtcctgctgaaaacccccataagcc   3000
       ............................................................
3001   agtgaacacagagcagctagaggctcctcctctgctggcttagggtcagaagtacctcac   3060
       ............................................................
3061   agtggttgtggacatggaagagttttgtcaacacaacactttgtccccgctccgggagat   3120
       ............................................................
3121   gagtcagatggtggcttgagttgtcacttggtcccctccgcccctcgggtggcccccttt   3180
       ............................................................
3181   gccacgtccccttagcttagtgatcaggtgtgagagtggccatttccttacctttgatcc   3240
       ............................................................
3241   ctgtaaagcagaaaggactcctttgacaggcgacaaactactgtggtgagcagaatgatt   3300
       ............................................................
3301   tcctttttcaagacaacacctgcctggcttctattaatgtgtgctggccatgatattgcc   3360
       ............................................................
3361   ccaaatccgccccactgaagtgttccctaaggaacagcatttctctgctcctcagtcaac   3420
       ............................................................
3421   ccccgtagcctagagcagtgtcacaagcttcagtaaggccagtcagctggaagtcagtct   3480
       ............................................................
3481   accgtatagtaacactgtatttcagtctacagaccacactctagttgttttccatgaaag   3540
       ............................................................
3541   gtatacaaatgaagaattttctagcaaaacatgtttttaaccatcagtgctcaattgcat   3600
       ............................................................
3601   tttcttcctttcgcagccagtcagtctttcaaactattgacagtaagataattctcacgt   3660
       ............................................................
3661   tcacacctggtggcaggcttcactgtagggacggacattgcagttacaccacgattcctt   3720
       ............................................................
3721   cctcttcactggctcgaggtaaacccttttcaaggaaaaacaactctaggatttcttttt   3780
       ............................................................
3781   tctgtgtacgtagaccagtcccatcagtgtataatctctctctcacacgcctctctccaa   3840
       ............................................................
3841   tagacagcttgtatttgcagtatttcatatttataaatatgcgtttatttaaaaggagaa   3900
       ............................................................
3901   caaaagcttgactctgattcacagttttgtatgtagctggtttgacgtagtcttttgtat   3960
       ............................................................
3961   tttccctgccgaagtgaattgttggagaatgtaaaccgcctccacgtggcggcagacttc   4020
       ............................................................
4021   ctaaggccccagctcgctggcctcgcgctgggcggctgggaattccacctgagaacaagt   4080
       ............................................................
4081   cccgcaaaccggggacggaaggacatttgacttttatttttgtatttaattgacatgaat   4140
       ............................................................
4141   gtaaaggggacagctcagggttgttttggagcctgttgactttgtatctctgcctgtgat   4200
       ............................................................
4201   tttcttttctaaatgaaactccatgtagcaaccaggacgaagttgagaaggaaaacgcca   4260
       ............................................................
4261   aatgctttggttattagagtttaataggtaagctctgttacactaggtgttagagttcca   4320
       ............................................................
4321   gaatgttcttttgtttgctaaaccttgaagaaacatgtgcctcagcctagatgttttgtc   4380
       ............................................................
4381   ttctcttttctgcacttaatacctgacagtatgaccgatctctgcgcctttctgggggcg   4440
       ............................................................
4441   ggcaagctggcggtagatttgtgatgtcacagtgcaaactgcagtgactgtaaattggcc   4500
       ............................................................
4501   tggcgtgtataaacgttttcagggaatgcagaaggtattaatgaagagacaaaaccttta   4560
       ............................................................
4561   ttccatgtgctttgcttcattctgtacatagctctttggctcgtgaacctaattgtaaac   4620
       ............................................................
4621   tttcaggtatttttgtacaaataagggactgatgttctgtttcttgtaattagaaataaa   4680
       ............................................................
4681   cattaatacagtgttcttcattttcaaaaaaaa                              4740
       .................................