Imprinted Gene Databases

Homo sapiens: GNAS

GNAS complex locus
Species Gene Aliases Location Status Expressed Allele
Ovis aries GNAS   13  Imprinted Maternal
Homo sapiens GNAS AHO, GSA, GSP, POH, GPSA, NESP, GNAS1, PHP1A, PHP1B, C20orf45, MGC33735, dJ309F20.1.1, dJ806M20.3.3  20q13.3  Imprinted Isoform Dependent
Mus musculus Gnas P1, P2, P3, GSP, Gsa, POH, GPSA, Nesp, Gnas1, Nespl, PHP1A, PHP1B, Gnasxl, Nesp55, Oedsml, Oed-Sml, Gs-alpha, XLalphas, MGC118029, 5530400H20Rik, A930027G11Rik, C130027O20Rik  2 104.0 cM  Imprinted Isoform Dependent
Bos taurus GNAS GNAS1  13q22  Imprinted Maternal
1      ggcgggggcccggccgaggcaataagagcggcggcggcggcagcggcggcagcagctccc     60
       ............................................................
61     gcagctcctgctctggtccgcctcggcccggcggcggccatcagccccctcggcctcggc    120
       ............................................................
121    tcgaggggcggggagctgcgcgcgcccctcggtccgaccgacaccctccccttcccgccc    180
       ............................................................
181    gtccgcgcgccccgcggcccgcggcccgcagtccgccccgcgcgctccttgccgaggagc    240
       ............................................................
241    cgagcccgcgcccggcccgcccgcccggcgctgccccggccctcccggcccgcgtgaggc    300
       ............................................................
301    cgcccgcgcccgccgccgccgcagcccggccgcgccccgccgccgccgccgccgccATGG    360
       ........................................................M--G
361    GCTGCCTCGGGAACAGTAAGACCGAGGACCAGCGCAACGAGGAGAAGGCGCAGCGTGAGG    420
       --C--L--G--N--S--K--T--E--D--Q--R--N--E--E--K--A--Q--R--E--A
421    CCAACAAAAAGATCGAGAAGCAGCTGCAGAAGGACAAGCAGGTCTACCGGGCCACGCACC    480
       --N--K--K--I--E--K--Q--L--Q--K--D--K--Q--V--Y--R--A--T--H--R
481    GCCTGCTGCTGCTGGGTGCTGGAGAATCTGGTAAAAGCACCATTGTGAAGCAGATGAGGA    540
       --L--L--L--L--G--A--G--E--S--G--K--S--T--I--V--K--Q--M--R--I
541    TCCTGCATGTTAATGGGTTTAATGGAGAGGGCGGCGAAGAGGACCCGCAGGCTGCAAGGA    600
       --L--H--V--N--G--F--N--G--E--G--G--E--E--D--P--Q--A--A--R--S
601    GCAACAGCGATGGTGAGAAGGCAACCAAAGTGCAGGACATCAAAAACAACCTGAAAGAGG    660
       --N--S--D--G--E--K--A--T--K--V--Q--D--I--K--N--N--L--K--E--A
661    CGATTGAAACCATTGTGGCCGCCATGAGCAACCTGGTGCCCCCCGTGGAGCTGGCCAACC    720
       --I--E--T--I--V--A--A--M--S--N--L--V--P--P--V--E--L--A--N--P
721    CCGAGAACCAGTTCAGAGTGGACTACATCCTGAGTGTGATGAACGTGCCTGACTTTGACT    780
       --E--N--Q--F--R--V--D--Y--I--L--S--V--M--N--V--P--D--F--D--F
781    TCCCTCCCGAATTCTATGAGCATGCCAAGGCTCTGTGGGAGGATGAAGGAGTGCGTGCCT    840
       --P--P--E--F--Y--E--H--A--K--A--L--W--E--D--E--G--V--R--A--C
841    GCTACGAACGCTCCAACGAGTACCAGCTGATTGACTGTGCCCAGTACTTCCTGGACAAGA    900
       --Y--E--R--S--N--E--Y--Q--L--I--D--C--A--Q--Y--F--L--D--K--I
901    TCGACGTGATCAAGCAGGCTGACTATGTGCCGAGCGATCAGGACCTGCTTCGCTGCCGTG    960
       --D--V--I--K--Q--A--D--Y--V--P--S--D--Q--D--L--L--R--C--R--V
961    TCCTGACTTCTGGAATCTTTGAGACCAAGTTCCAGGTGGACAAAGTCAACTTCCACATGT   1020
       --L--T--S--G--I--F--E--T--K--F--Q--V--D--K--V--N--F--H--M--F
1021   TTGACGTGGGTGGCCAGCGCGATGAACGCCGCAAGTGGATCCAGTGCTTCAACGATGTGA   1080
       --D--V--G--G--Q--R--D--E--R--R--K--W--I--Q--C--F--N--D--V--T
1081   CTGCCATCATCTTCGTGGTGGCCAGCAGCAGCTACAACATGGTCATCCGGGAGGACAACC   1140
       --A--I--I--F--V--V--A--S--S--S--Y--N--M--V--I--R--E--D--N--Q
1141   AGACCAACCGCCTGCAGGAGGCTCTGAACCTCTTCAAGAGCATCTGGAACAACAGATGGC   1200
       --T--N--R--L--Q--E--A--L--N--L--F--K--S--I--W--N--N--R--W--L
1201   TGCGCACCATCTCTGTGATCCTGTTCCTCAACAAGCAAGATCTGCTCGCTGAGAAAGTCC   1260
       --R--T--I--S--V--I--L--F--L--N--K--Q--D--L--L--A--E--K--V--L
1261   TTGCTGGGAAATCGAAGATTGAGGACTACTTTCCAGAATTTGCTCGCTACACTACTCCTG   1320
       --A--G--K--S--K--I--E--D--Y--F--P--E--F--A--R--Y--T--T--P--E
1321   AGGATGCTACTCCCGAGCCCGGAGAGGACCCACGCGTGACCCGGGCCAAGTACTTCATTC   1380
       --D--A--T--P--E--P--G--E--D--P--R--V--T--R--A--K--Y--F--I--R
1381   GAGATGAGTTTCTGAGGATCAGCACTGCCAGTGGAGATGGGCGTCACTACTGCTACCCTC   1440
       --D--E--F--L--R--I--S--T--A--S--G--D--G--R--H--Y--C--Y--P--H
1441   ATTTCACCTGCGCTGTGGACACTGAGAACATCCGCCGTGTGTTCAACGACTGCCGTGACA   1500
       --F--T--C--A--V--D--T--E--N--I--R--R--V--F--N--D--C--R--D--I
1501   TCATTCAGCGCATGCACCTTCGTCAGTACGAGCTGCTCTAAgaagggaacccccaaattt   1560
       --I--Q--R--M--H--L--R--Q--Y--E--L--L--***...................
1561   aattaaagccttaagcacaattaattaaaagtgaaacgtaattgtacaagcagttaatca   1620
       ............................................................
1621   cccaccatagggcatgattaacaaagcaacctttcccttcccccgagtgattttgcgaaa   1680
       ............................................................
1681   cccccttttcccttcagcttgcttagatgttccaaatttagaaagcttaaggcggcctac   1740
       ............................................................
1741   agaaaaaggaaaaaaggccacaaaagttccctctcactttcagtaaaaataaataaaaca   1800
       ............................................................
1801   gcagcagcaaacaaataaaatgaaataaaagaaacaaatgaaataaatattgtgttgtgc   1860
       ............................................................
1861   agcattaaaaaaaatcaaaataaaaattaaatgtgagcaaagaatgaaaaaaaaaaaaaa   1920
       ............................................................
1921   aaaaaa                                                         1980
       ......