Imprinted Gene Databases

Homo sapiens: GATM

Glycine amidinotransferase
Species Gene Aliases Location Status Expressed Allele
Sus scrofa GATM AGAT  Not Imprinted Biallelic
Mus musculus Gatm AT, AI314789, 1810003P21Rik  2 69.0 cM  Imprinted Maternal
Homo sapiens GATM AT, AGAT  15q21.1  Unknown Unknown
1      ttgcgacgctcgggtctgggtccgggtccggacgtgcaacagaagccgtcagtggccccg     60
61     ctggctaaaaaagggcaagcatcggaggctcgagccagcggccgcggcgcttcccgacag    120
121    ttcctaattcggggcgctacgccggccccaccacctgttcccggcagccaatggggccgc    180
181    ggggggcggccggggcggagcgcggctacaaaaggcctcgggccccgcgcgcccgcccac    240
241    cccgctccgggcgcgctctcgggaaggcttggaccgacgcggcccagaggccaggaacat    300
301    tccgcgcgtggaccagccgggccagggcgATGCTGCGGGTGCGGTGTCTGCGCGGCGGGA    360
1621   tggctggcctcagatacacctaagaagcttaggggcaaggttcattctcctgctttaaaa   1680
1681   agtgcatgaactgtagtgctttaaacaatcatctccttaacaggggtcgtaagcctggtt   1740
1741   tgcttctattacttttctttgacataaagaaaataacttctgctaggtattactctctac   1800
1801   tcctaaagttatttactatttggcttcaagtataaaattttggtgaatgtgtaccaagaa   1860
1861   aaaattagtcacctgagtaacttggccactaataattaaccatctacctctgtttttaat   1920
1921   tttctttccaaaaggcagcttgaaatgttggtcctaatcttaattttttttcctcttcta   1980
1981   tagacttgagaatgtttttctctaaatgagagaaagacttagaatgtacacagatccaaa   2040
2041   atagaatcagattatctctttttttctaaaggagagaaagacttagaacatacacagatc   2100
2101   ctaagtagaaccaggtaattgtctctttttctaataaggaatttgggtaatttttaattt   2160
2161   tttgttttttaaaaaataacctagactatgcaaaacatcaaagtgaattttccatgaatg   2220
2221   tttttaatattctcatctcaacattgtgatatatgctactaaaaaccttttcatatacat   2280
2281   cttacctcatttcaagtgaattattttaatctttttctctctttccaaaaatttaggaat   2340
2341   gtttagtgtaattggatttcgctatcagttcccatccttaagttttgatattcaatatct   2400
2401   gatagatacactgcatctttggtcatctaagatttgtttacaaatgtgcaaattatttag   2460
2461   agcatagactttataagcattaaaaaaaactaatggaggtaaaacctaaatgcgatgtga   2520
2521   aataattttagtgttgataccgtatgtgtatttttattctaataaacttttgtgttccag   2580
2581   attgaaaaaaaaaaaaaaaaaa                                         2640