Imprinted Gene Databases

Homo sapiens: GABRB3

Gamma-aminobutyric acid A receptor, beta 3
Species Gene Aliases Location Status Expressed Allele
Mus musculus Gabrb3 Cp1, Gabrb-3, AW049585, A230092K12Rik  7 28.6 cM  Unknown Unknown
Homo sapiens GABRB3 MGC9051  15q11.2-q12  Conflicting Data Paternal
1      ctcctcccctccccctccgccctcctccgctccgggccagcgcggcggcggcggcggcgg     60
       ............................................................
61     cggcagcagcaggagcagccccggctgcgggtcgcgacggcggcggggcgccccctcccc    120
       ............................................................
121    cgtgccggggcgcggcggagggATGTGGGGCCTTGCGGGAGGAAGGCTTTTCGGCATCTT    180
       ......................M--W--G--L--A--G--G--R--L--F--G--I--F-
181    CTCGGCCCCGGTGCTGGTGGCTGTGGTGTGCTGCGCCCAGAGTGTGAACGATCCCGGGAA    240
       -S--A--P--V--L--V--A--V--V--C--C--A--Q--S--V--N--D--P--G--N-
241    CATGTCCTTTGTGAAGGAGACGGTGGACAAGCTGTTGAAAGGCTACGACATTCGCCTAAG    300
       -M--S--F--V--K--E--T--V--D--K--L--L--K--G--Y--D--I--R--L--R-
301    ACCCGACTTCGGGGGTCCCCCGGTCTGCGTGGGGATGAACATCGACATCGCCAGCATCGA    360
       -P--D--F--G--G--P--P--V--C--V--G--M--N--I--D--I--A--S--I--D-
361    CATGGTTTCCGAAGTCAACATGGATTATACCTTAACCATGTATTTTCAACAATATTGGAG    420
       -M--V--S--E--V--N--M--D--Y--T--L--T--M--Y--F--Q--Q--Y--W--R-
421    AGATAAAAGGCTCGCCTATTCTGGGATCCCTCTCAACCTCACGCTTGACAATCGAGTGGC    480
       -D--K--R--L--A--Y--S--G--I--P--L--N--L--T--L--D--N--R--V--A-
481    TGACCAGCTATGGGTGCCCGACACATATTTCTTAAATGACAAAAAGTCATTTGTGCATGG    540
       -D--Q--L--W--V--P--D--T--Y--F--L--N--D--K--K--S--F--V--H--G-
541    AGTGACAGTGAAAAACCGCATGATCCGTCTTCACCCTGATGGGACAGTGCTGTATGGGCT    600
       -V--T--V--K--N--R--M--I--R--L--H--P--D--G--T--V--L--Y--G--L-
601    CAGAATCACCACGACAGCAGCATGCATGATGGACCTCAGGAGATACCCCCTGGACGAGCA    660
       -R--I--T--T--T--A--A--C--M--M--D--L--R--R--Y--P--L--D--E--Q-
661    GAACTGCACTCTGGAAATTGAAAGCTATGGCTACACCACGGATGACATTGAGTTTTACTG    720
       -N--C--T--L--E--I--E--S--Y--G--Y--T--T--D--D--I--E--F--Y--W-
721    GCGAGGCGGGGACAAGGCTGTTACCGGAGTGGAAAGGATTGAGCTCCCGCAGTTCTCCAT    780
       -R--G--G--D--K--A--V--T--G--V--E--R--I--E--L--P--Q--F--S--I-
781    CGTGGAGCACCGTCTGGTCTCGAGGAATGTTGTCTTCGCCACAGGTGCCTATCCTCGACT    840
       -V--E--H--R--L--V--S--R--N--V--V--F--A--T--G--A--Y--P--R--L-
841    GTCACTGAGCTTTCGGTTGAAGAGGAACATTGGATACTTCATTCTTCAGACTTATATGCC    900
       -S--L--S--F--R--L--K--R--N--I--G--Y--F--I--L--Q--T--Y--M--P-
901    CTCTATACTGATAACGATTCTGTCGTGGGTGTCCTTCTGGATCAATTATGATGCATCTGC    960
       -S--I--L--I--T--I--L--S--W--V--S--F--W--I--N--Y--D--A--S--A-
961    TGCTAGAGTTGCCCTCGGGATCACAACTGTGCTGACAATGACAACCATCAACACCCACCT   1020
       -A--R--V--A--L--G--I--T--T--V--L--T--M--T--T--I--N--T--H--L-
1021   TCGGGAGACCTTGCCCAAAATCCCCTATGTCAAAGCCATTGACATGTACCTTATGGGCTG   1080
       -R--E--T--L--P--K--I--P--Y--V--K--A--I--D--M--Y--L--M--G--C-
1081   CTTCGTCTTTGTGTTCCTGGCCCTTCTGGAGTATGCCTTTGTCAACTACATTTTCTTTGG   1140
       -F--V--F--V--F--L--A--L--L--E--Y--A--F--V--N--Y--I--F--F--G-
1141   AAGAGGCCCTCAAAGGCAGAAGAAGCTTGCAGAAAAGACAGCCAAGGCAAAGAATGACCG   1200
       -R--G--P--Q--R--Q--K--K--L--A--E--K--T--A--K--A--K--N--D--R-
1201   TTCAAAGAGCGAAAGCAACCGGGTGGATGCTCATGGAAATATTCTGTTGACATCGCTGGA   1260
       -S--K--S--E--S--N--R--V--D--A--H--G--N--I--L--L--T--S--L--E-
1261   AGTTCACAATGAAATGAATGAGGTCTCAGGCGGCATTGGCGATACCAGGAATTCAGCAAT   1320
       -V--H--N--E--M--N--E--V--S--G--G--I--G--D--T--R--N--S--A--I-
1321   ATCCTTTGACAACTCAGGAATCCAGTACAGGAAACAGAGCATGCCTCGAGAAGGGCATGG   1380
       -S--F--D--N--S--G--I--Q--Y--R--K--Q--S--M--P--R--E--G--H--G-
1381   GCGATTCCTGGGGGACAGAAGCCTCCCGCACAAGAAGACCCATCTACGGAGGAGGTCTTC   1440
       -R--F--L--G--D--R--S--L--P--H--K--K--T--H--L--R--R--R--S--S-
1441   ACAGCTCAAAATTAAAATACCTGATCTAACCGATGTGAATGCCATAGACAGATGGTCCAG   1500
       -Q--L--K--I--K--I--P--D--L--T--D--V--N--A--I--D--R--W--S--R-
1501   GATCGTGTTTCCATTCACTTTTTCTCTTTTCAACTTAGTTTACTGGCTGTACTATGTTAA   1560
       -I--V--F--P--F--T--F--S--L--F--N--L--V--Y--W--L--Y--Y--V--N-
1561   CTGAgtgactgtacttgatttttcaaagacttcatttaacactgagtgaaatattactct   1620
       -***........................................................
1621   gcctgtcaagtttttatacctgtacacacacagacacacaagcagacacacacatatata   1680
       ............................................................
1681   catacgcaattgtatatatatgtgaactttctcagcatatatataaaatacacgtgtata   1740
       ............................................................
1741   tgaggatgtatgtgtatatgtttatacacacaggagtcagtgcccatgtgtatggaagac   1800
       ............................................................
1801   aaatacacatacatatatacattttgcagctatggacaatttaccacaggatgcatatta   1860
       ............................................................
1861   aagaaagtcatagtttttttcttttttaattgaaagggacaagtatcatctaaatattat   1920
       ............................................................
1921   gccttgagaatgagggcgtgaaacacaatatcatccccaaatgtgtcttgtattatcata   1980
       ............................................................
1981   agttagatgttttagtttaaaaatcagaaagacattcttagttaatctttgaaaactcat   2040
       ............................................................
2041   acagtggtattgctagtttaaaatgagtcacttacttcatatcctctcgttcagtttagt   2100
       ............................................................
2101   aagcaaaggcttcttggcttctctggtgatggggtttgttttcatcgggcatacgttttc   2160
       ............................................................
2161   tgcaatggtttagtggctggggtgagccactggcagtgtgcttacctgttgtctgaaaca   2220
       ............................................................
2221   tagatagatcccacgttgatgtctgaacgaccgtcttttgaaaactcatcgggagtgaat   2280
       ............................................................
2281   ggcatctcgttgtaagtactctaatatacagtgtgtagtttgtttctgttgttcacttgg   2340
       ............................................................
2341   agtggatccagcttcactgtcatgtgcgaacacagtgacacgtttggccagtgacatttc   2400
       ............................................................
2401   aatcactgaaaatgtgctctacatctcgtatggatttctaggcctgatatccaacagaaa   2460
       ............................................................
2461   gcatagacgtctcaggttattcgttactctaaggtaaaaccatctaggatgattttcccc   2520
       ............................................................
2521   cttgcagttatgttatcattcttataacattgtatgttaatagaaaatatatttgcataa   2580
       ............................................................
2581   tatgcatatatatgtatatttaccaagattttgtttcttacgcttgctatcatggcagca   2640
       ............................................................
2641   tgcgatgtcatattttcctttatgtgatgtaactactttctgttatctagaaattaagat   2700
       ............................................................
2701   tgaagctaaaacacttctactgttcaatttcagaaactaagaatcatcctcatgccttta   2760
       ............................................................
2761   tttctgtatctgacatatttcataagcacatccaactactcctagactgactaggattct   2820
       ............................................................
2821   gcaggaacatgacccgtacacaccacgcgtcacccaacgacccatgaccgttctctgagg   2880
       ............................................................
2881   caaaggagggcaacctgacagcaaacacagtcactgttggttccttctgatccacagcct   2940
       ............................................................
2941   catcagtatttggactttttaaagctcgtagaaacaagacaaggtgcaccggtttcatag   3000
       ............................................................
3001   acgcaaccttaacttactatttagatgagatctttctaaagaaaaaaaaaagagatgata   3060
       ............................................................
3061   tattttttgtaaacaatatttctatcacaggcatccataaactgaaatgactacagttgt   3120
       ............................................................
3121   gcaaacaggtgtcacagtgaagttgagcatttggagaaaaaaataaaaagcaaaatttgc   3180
       ............................................................
3181   aggaagaactgctaaattaatactttatcccaaaatgccacgtatgcctcaccctctctg   3240
       ............................................................
3241   ttctatccaaaaccaaggaccagagtgctccaatggtaggccccagttgtctcgatgtag   3300
       ............................................................
3301   gtagaggcaccaccctccccgaggatgcgtgtggtgtggactatccccatgagctgacca   3360
       ............................................................
3361   ctacttgatttttctttggtggccgtaacaacctttaatttgtgggcatctgcaacagtt   3420
       ............................................................
3421   caaaacccaccatcagataaaacataatccacaaaatctcacgctagaggcaattaccta   3480
       ............................................................
3481   cttttagacccttttccctctttcattcctatctttttcctcctaatcgctgctctctgg   3540
       ............................................................
3541   ttttattttcatctggagactagccagggatttctttggctttggcttttctctgaccat   3600
       ............................................................
3601   tttttccatgggtaacaatgggggatcctaaaagttaaacagattgggaaaaaccttgtt   3660
       ............................................................
3661   aagtggccttatcattattatcatgttaaagaaaaaaaatacatttgcaaagaccttatc   3720
       ............................................................
3721   cctttcaatacttcaggtatctttttctgtatccagtaattaaaggtgtgaggtccacat   3780
       ............................................................
3781   gcagaagagggaccccaaaatgtaaatggatgtggacaaaaacagtcaatggtctattta   3840
       ............................................................
3841   agtgtataatttatactattcagaactgtgacattaattctttctgggagaaaagtgatt   3900
       ............................................................
3901   taaaacttttttgatgcatagttgaggtacccaaatatcaaaggcagagaccccatgggg   3960
       ............................................................
3961   ctccaaagagctgcagtctccttcccaaggttttctggatataaatttgcatggtatagt   4020
       ............................................................
4021   cataatagcttttgagctttttatatgcatttggcaccaagactgggatccacaactttg   4080
       ............................................................
4081   tagacactgcgatgaagttaacatattagctatactataaatagtgtttgtaactacaca   4140
       ............................................................
4141   cacacacacacacacacacacaaatacatacatatattctgtaaaaacaaaaaaaaactt   4200
       ............................................................
4201   tttaagatccttgggtatgtgtttgctttactccatttcagaagaaaattacttttcttc   4260
       ............................................................
4261   taacaaaattattttatagcttctccatttttaaaacttgtgagagcattgagaagagaa   4320
       ............................................................
4321   ctctgactgtgttaacagaagagagttgaattggagtctctgttgtgttaaaatgacctc   4380
       ............................................................
4381   tcgttactccacagtagttatttgagccagtgactgagtcgcgttgaggaattctgaacc   4440
       ............................................................
4441   cggacctctgacgttgttgggaggtggctgttacccacacccagacctcttgagtaagga   4500
       ............................................................
4501   cagaaacgttatcattggggatataatgagatttctttcttaacaattgaaagtaataaa   4560
       ............................................................
4561   gagttaattttctcagtagtcctgtctttccaaaatgcgccacaggggctcaagatctac   4620
       ............................................................
4621   agaagaatcttgttatgacagtttgttattacccatattcagatatccttgagataatgg   4680
       ............................................................
4681   aagagccctgctacataactccctacagagaaagactgatagacttgagtagtccttaaa   4740
       ............................................................
4741   acaagtgttattcctgttcaccaaccccgggactgtggaggggtttcactgtctatacca   4800
       ............................................................
4801   tgcgacatccatttcccctgaatctcaaacgaactagaaagtatgtcatgataatatttc   4860
       ............................................................
4861   cattagatttggaagctacctgtacatctgcaatattgtgtttttaacgccagcacccag   4920
       ............................................................
4921   aactttgacatgttcagtcactccctgaaaggcacttctctcttgtccaaacacagcgtt   4980
       ............................................................
4981   gacatttttactgaggagatcatctcaaaggtgatgccaaacgagtctggggctggtttt   5040
       ............................................................
5041   aaggggacaggcacattgcagttgtaggtgttcattttcagcatctagtagataatccat   5100
       ............................................................
5101   tggtgtttgtcccaccattggtgtattctaacaagaatgtgtccaactttgaatctcctg   5160
       ............................................................
5161   gcttgaaagtataaaccatcacttaattcttattttaactctccacctgaaaaccagttc   5220
       ............................................................
5221   atatttctggccattttatgtaagcaaaactgaacaattggtgaaacattttgttactct   5280
       ............................................................
5281   tggaattgactctggctgtcagtgtgagccattagagtaacatcgaatcttggggcaaag   5340
       ............................................................
5341   aactgcccaggtgaattaaatttttccaggacactagctagtgtgccttggattgattac   5400
       ............................................................
5401   ctcttctactgcattgaaaggcgccatgttttcctgaaatactaaattcccaacacctgg   5460
       ............................................................
5461   gtaaacaatgaccttccagagagtggctcccgtatgcctctccctaggaccaaccccatg   5520
       ............................................................
5521   aacatgttttgtcacgtttgtctcatgtttctacttcacaagtcagtgagtgtgtttaag   5580
       ............................................................
5581   gtaagtacaggattattctagtaggaataggcgattgctgtcataatcaattctcatgtt   5640
       ............................................................
5641   gatttcattttattgtaaagataaatttaaacccagttttgcttaagcacattgatgtaa   5700
       ............................................................
5701   ttttttggtattatttgacatgaaaaaacagcaaaattgagtgatagatacaatatgaaa   5760
       ............................................................
5761   cttgttgatgaatgaattcaaatttattaaaaaaggagtaactgacctaaa            5820
       ...................................................