Imprinted Gene Databases

Homo sapiens: DLX5

Distal-less homeobox 5
Species Gene Aliases Location Status Expressed Allele
Sus scrofa DLX5     Imprinted Maternal
Mus musculus Dlx5 AI385752  6 2.0 cM  Not Imprinted Biallelic
Homo sapiens DLX5   7q22  Imprinted Maternal
1      agcagtcagccggccggagacagagacttcacgactcccagtctcctcctcgccgcggcc     60
61     gccgcctcctccttctctcctcctcctcttcctcctcctccctcgctcccacagccatgt    120
121    ctgcttagaccagagcagccccacagccaactagggcagctgccgccgccacaacagcaa    180
181    ggacagccgctgccgccgcccgtgagcgATGACAGGAGTGTTTGACAGAAGGGTCCCCAG    240
1081   gggctgctctctcttactctcttttttgggactactgtgttttgctgttctagaaaatca   1140
1141   taaagaaaggaattcatatggggaagttcggaaaactgaaaaagattcatgtgtaaagct   1200
1201   tttttttgcatgtaagttattgcatttcaaaagaccccccctttttttacagaggacttt   1260
1261   ttttgcgcaactgtggacactttcaatggtgccttgaaatctatgacctcaacttttcaa   1320
1321   aagacttttttcaatgttattttagccatgtaaataagtgtagatagaggaattaaactg   1380
1381   tatattctggataaataaaattatttcgaccatgaaaagcggaa                   1440