Imprinted Gene Databases

Homo sapiens: DLX5

Distal-less homeobox 5
Species Gene Aliases Location Status Expressed Allele
Sus scrofa DLX5     Imprinted Maternal
Homo sapiens DLX5   7q22  Imprinted Maternal
Mus musculus Dlx5 AI385752  6 2.0 cM  Not Imprinted Biallelic
1      agcagtcagccggccggagacagagacttcacgactcccagtctcctcctcgccgcggcc     60
       ............................................................
61     gccgcctcctccttctctcctcctcctcttcctcctcctccctcgctcccacagccatgt    120
       ............................................................
121    ctgcttagaccagagcagccccacagccaactagggcagctgccgccgccacaacagcaa    180
       ............................................................
181    ggacagccgctgccgccgcccgtgagcgATGACAGGAGTGTTTGACAGAAGGGTCCCCAG    240
       ............................M--T--G--V--F--D--R--R--V--P--S-
241    CATCCGATCCGGCGACTTCCAAGCTCCGTTCCAGACGTCCGCAGCTATGCACCATCCGTC    300
       -I--R--S--G--D--F--Q--A--P--F--Q--T--S--A--A--M--H--H--P--S-
301    TCAGGAATCGCCAACTTTGCCCGAGTCTTCAGCTACCGATTCTGACTACTACAGCCCTAC    360
       -Q--E--S--P--T--L--P--E--S--S--A--T--D--S--D--Y--Y--S--P--T-
361    GGGGGGAGCCCCGCACGGCTACTGCTCTCCTACCTCGGCTTCCTATGGCAAAGCTCTCAA    420
       -G--G--A--P--H--G--Y--C--S--P--T--S--A--S--Y--G--K--A--L--N-
421    CCCCTACCAGTATCAGTATCACGGCGTGAACGGCTCCGCCGGGAGCTACCCAGCCAAAGC    480
       -P--Y--Q--Y--Q--Y--H--G--V--N--G--S--A--G--S--Y--P--A--K--A-
481    TTATGCCGACTATAGCTACGCTAGCTCCTACCACCAGTACGGCGGCGCCTACAACCGCGT    540
       -Y--A--D--Y--S--Y--A--S--S--Y--H--Q--Y--G--G--A--Y--N--R--V-
541    CCCAAGCGCCACCAACCAGCCAGAGAAAGAAGTGACCGAGCCCGAGGTGAGAATGGTGAA    600
       -P--S--A--T--N--Q--P--E--K--E--V--T--E--P--E--V--R--M--V--N-
601    TGGCAAACCAAAGAAAGTTCGTAAACCCAGGACTATTTATTCCAGCTTTCAGCTGGCCGC    660
       -G--K--P--K--K--V--R--K--P--R--T--I--Y--S--S--F--Q--L--A--A-
661    ATTACAGAGAAGGTTTCAGAAGACTCAGTACCTCGCCTTGCCGGAACGCGCCGAGCTGGC    720
       -L--Q--R--R--F--Q--K--T--Q--Y--L--A--L--P--E--R--A--E--L--A-
721    CGCCTCGCTGGGATTGACACAAACACAGGTGAAAATCTGGTTTCAGAACAAAAGATCCAA    780
       -A--S--L--G--L--T--Q--T--Q--V--K--I--W--F--Q--N--K--R--S--K-
781    GATCAAGAAGATCATGAAAAACGGGGAGATGCCCCCGGAGCACAGTCCCAGCTCCAGCGA    840
       -I--K--K--I--M--K--N--G--E--M--P--P--E--H--S--P--S--S--S--D-
841    CCCAATGGCGTGTAACTCGCCGCAGTCTCCAGCGGTGTGGGAGCCCCAGGGCTCGTCCCG    900
       -P--M--A--C--N--S--P--Q--S--P--A--V--W--E--P--Q--G--S--S--R-
901    CTCGCTCAGCCACCACCCTCATGCCCACCCTCCGACCTCCAACCAGTCCCCAGCGTCCAG    960
       -S--L--S--H--H--P--H--A--H--P--P--T--S--N--Q--S--P--A--S--S-
961    CTACCTGGAGAACTCTGCATCCTGGTACACAAGTGCAGCCAGCTCAATCAATTCCCACCT   1020
       -Y--L--E--N--S--A--S--W--Y--T--S--A--A--S--S--I--N--S--H--L-
1021   GCCGCCGCCGGGCTCCTTACAGCACCCGCTGGCGCTGGCCTCCGGGACACTCTATTAGat   1080
       -P--P--P--G--S--L--Q--H--P--L--A--L--A--S--G--T--L--Y--***..
1081   gggctgctctctcttactctcttttttgggactactgtgttttgctgttctagaaaatca   1140
       ............................................................
1141   taaagaaaggaattcatatggggaagttcggaaaactgaaaaagattcatgtgtaaagct   1200
       ............................................................
1201   tttttttgcatgtaagttattgcatttcaaaagaccccccctttttttacagaggacttt   1260
       ............................................................
1261   ttttgcgcaactgtggacactttcaatggtgccttgaaatctatgacctcaacttttcaa   1320
       ............................................................
1321   aagacttttttcaatgttattttagccatgtaaataagtgtagatagaggaattaaactg   1380
       ............................................................
1381   tatattctggataaataaaattatttcgaccatgaaaagcggaa                   1440
       ............................................