Imprinted Gene Databases

Homo sapiens: DLK1

Delta-like 1 homolog

Wylie et al., Genome Res 10: 1711-1718, 2000

Species Gene Aliases Location Status Expressed Allele
Homo sapiens DLK1 DLK, FA1, ZOG, pG2, PREF1, Pref-1  14q32  Imprinted Paternal
Mus musculus Dlk1 FA1, ZOG, pG2, Peg9, SCP1, Ly107, pref-1, AW742678  12 54.0 cM  Imprinted Paternal
Didelphis virginiana DLK1     Not Imprinted Biallelic
Ovis aries DLK1 DLK1  18  Imprinted Paternal
Sus scrofa DLK1   Imprinted Paternal
Gallus gallus domesticus DLK1   Not Imprinted Biallelic
Macaca mulatta DLK1   Imprinted Paternal
1      gagagcgcagcgcgcagcccggtgcagccctggctttcccctcgctgcgcgcccgcgccc     60
       ............................................................
61     cctttcgcgtccgcaaccagaagcccagtgcggcgccaggagccggacccgcgcccgcac    120
       ............................................................
121    cgctcccgggaccgcgaccccggccgcccagagATGACCGCGACCGAAGCCCTCCTGCGC    180
       .................................M--T--A--T--E--A--L--L--R--
181    GTCCTCTTGCTCCTGCTGGCTTTCGGCCACAGCACCTATGGGGCTGAATGCTTCCCGGCC    240
       V--L--L--L--L--L--A--F--G--H--S--T--Y--G--A--E--C--F--P--A--
241    TGCAACCCCCAAAATGGATTCTGCGAGGATGACAATGTTTGCAGGTGCCAGCCTGGCTGG    300
       C--N--P--Q--N--G--F--C--E--D--D--N--V--C--R--C--Q--P--G--W--
301    CAGGGTCCCCTTTGTGACCAGTGCGTGACCTCTCCCGGCTGCCTTCACGGACTCTGTGGA    360
       Q--G--P--L--C--D--Q--C--V--T--S--P--G--C--L--H--G--L--C--G--
361    GAACCCGGGCAGTGCATTTGCACCGACGGCTGGGACGGGGAGCTCTGTGATAGAGATGTT    420
       E--P--G--Q--C--I--C--T--D--G--W--D--G--E--L--C--D--R--D--V--
421    CGGGCCTGCTCCTCGGCCCCCTGTGCCAACAACGGGACCTGCGTGAGCCTGGACGATGGC    480
       R--A--C--S--S--A--P--C--A--N--N--G--T--C--V--S--L--D--D--G--
481    CTCTATGAATGCTCCTGTGCCCCCGGGTACTCGGGAAAGGACTGCCAGAAAAAGGACGGG    540
       L--Y--E--C--S--C--A--P--G--Y--S--G--K--D--C--Q--K--K--D--G--
541    CCCTGTGTGATCAACGGCTCCCCCTGCCAGCACGGAGGCACCTGCGTGGATGATGAGGGC    600
       P--C--V--I--N--G--S--P--C--Q--H--G--G--T--C--V--D--D--E--G--
601    CGGGCCTCCCATGCCTCCTGCCTGTGCCCCCCTGGCTTCTCAGGCAATTTCTGCGAGATC    660
       R--A--S--H--A--S--C--L--C--P--P--G--F--S--G--N--F--C--E--I--
661    GTGGCCAACAGCTGCACCCCCAACCCATGCGAGAACGACGGCGTCTGCACTGACATTGGG    720
       V--A--N--S--C--T--P--N--P--C--E--N--D--G--V--C--T--D--I--G--
721    GGCGACTTCCGCTGCCGGTGCCCAGCCGGCTTCATCGACAAGACCTGCAGCCGCCCGGTG    780
       G--D--F--R--C--R--C--P--A--G--F--I--D--K--T--C--S--R--P--V--
781    ACCAACTGCGCCAGCAGCCCGTGCCAGAACGGGGGCACCTGCCTGCAGCACACCCAGGTG    840
       T--N--C--A--S--S--P--C--Q--N--G--G--T--C--L--Q--H--T--Q--V--
841    AGCTACGAGTGTCTGTGCAAGCCCGAGTTCACAGGTCTCACCTGTGTCAAGAAGCGCGCG    900
       S--Y--E--C--L--C--K--P--E--F--T--G--L--T--C--V--K--K--R--A--
901    CTGAGCCCCCAGCAGGTCACCCGTCTGCCCAGCGGCTATGGGCTGGCCTACCGCCTGACC    960
       L--S--P--Q--Q--V--T--R--L--P--S--G--Y--G--L--A--Y--R--L--T--
961    CCTGGGGTGCACGAGCTGCCGGTGCAGCAGCCGGAGCACCGCATCCTGAAGGTGTCCATG   1020
       P--G--V--H--E--L--P--V--Q--Q--P--E--H--R--I--L--K--V--S--M--
1021   AAAGAGCTCAACAAGAAAACCCCTCTCCTCACCGAGGGCCAGGCCATCTGCTTCACCATC   1080
       K--E--L--N--K--K--T--P--L--L--T--E--G--Q--A--I--C--F--T--I--
1081   CTGGGCGTGCTCACCAGCCTGGTGGTGCTGGGCACTGTGGGTATCGTCTTCCTCAACAAG   1140
       L--G--V--L--T--S--L--V--V--L--G--T--V--G--I--V--F--L--N--K--
1141   TGCGAGACCTGGGTGTCCAACCTGCGCTACAACCACATGCTGCGGAAGAAGAAGAACCTG   1200
       C--E--T--W--V--S--N--L--R--Y--N--H--M--L--R--K--K--K--N--L--
1201   CTGCTTCAGTACAACAGCGGGGAGGACCTGGCCGTCAACATCATCTTCCCCGAGAAGATC   1260
       L--L--Q--Y--N--S--G--E--D--L--A--V--N--I--I--F--P--E--K--I--
1261   GACATGACCACCTTCAGCAAGGAGGCCGGCGACGAGGAGATCTAAgcagcgttcccacag   1320
       D--M--T--T--F--S--K--E--A--G--D--E--E--I--***...............
1321   ccccctctagattcttggagttccgcagagcttactatacgcggtctgtcctaatctttg   1380
       ............................................................
1381   tggtgttcgctatctcttgtgtcaaatctggtgaacgctacgcttacatatattgtcttt   1440
       ............................................................
1441   gtgctgctgtgtgacaaacgcaatgcaaaaacaatcctctttctctctcttaatgcatga   1500
       ............................................................
1501   tacagaataataataagaatttcatctttaaa                               1560
       ................................