Imprinted Gene Databases

Homo sapiens: DLK1

Delta-like 1 homolog

Wylie et al., Genome Res 10: 1711-1718, 2000

Species Gene Aliases Location Status Expressed Allele
Gallus gallus domesticus DLK1   Not Imprinted Biallelic
Sus scrofa DLK1   Imprinted Paternal
Ovis aries DLK1 DLK1  18  Imprinted Paternal
Mus musculus Dlk1 FA1, ZOG, pG2, Peg9, SCP1, Ly107, pref-1, AW742678  12 54.0 cM  Imprinted Paternal
Homo sapiens DLK1 DLK, FA1, ZOG, pG2, PREF1, Pref-1  14q32  Imprinted Paternal
Macaca mulatta DLK1   Imprinted Paternal
Didelphis virginiana DLK1     Not Imprinted Biallelic
1      gagagcgcagcgcgcagcccggtgcagccctggctttcccctcgctgcgcgcccgcgccc     60
61     cctttcgcgtccgcaaccagaagcccagtgcggcgccaggagccggacccgcgcccgcac    120
121    cgctcccgggaccgcgaccccggccgcccagagATGACCGCGACCGAAGCCCTCCTGCGC    180
1321   ccccctctagattcttggagttccgcagagcttactatacgcggtctgtcctaatctttg   1380
1381   tggtgttcgctatctcttgtgtcaaatctggtgaacgctacgcttacatatattgtcttt   1440
1441   gtgctgctgtgtgacaaacgcaatgcaaaaacaatcctctttctctctcttaatgcatga   1500
1501   tacagaataataataagaatttcatctttaaa                               1560