Imprinted Gene Databases

Homo sapiens: DIO3

Deiodinase, iodothyronine, type III
Species Gene Aliases Location Status Expressed Allele
Sus scrofa DIO3 5DIII, DIOIII  Imprinted Paternal
Ovis aries DIO3 DIO3, 5DIII, DIOIII    Imprinted Paternal
Mus musculus Dio3 MGC124117, MGC124118  12 F1  Imprinted Paternal
Macropus eugenii DIO3     Not Imprinted Biallelic
Homo sapiens DIO3 D3, 5DIII, TXDI3, DIOIII  14q32  Unknown Unknown
1      agcccaagatttctagggcattggccgcgctgctgggtgatccctccgggctcaagttgc     60
       ............................................................
61     aagggggcgggccgggccggaggtggagtctcccgccaattgaagcctccgctataaatt    120
       ............................................................
121    gaactccctgcactgctgaagcccagATGCCTCGCCAGGCCACGTCGCGGTTGGTGGTCG    180
       ..........................M--P--R--Q--A--T--S--R--L--V--V--G
181    GAGAGGGCGAGGGGTCCCAGGGGGCTTCGGGGCCTGCAGCCACCATGCTCCGCTCCCTGC    240
       --E--G--E--G--S--Q--G--A--S--G--P--A--A--T--M--L--R--S--L--L
241    TGCTTCACTCCTTGAGGCTCTGCGCCCAGACCGCCTCGTGCCTCGTGCTCTTCCCGCGCT    300
       --L--H--S--L--R--L--C--A--Q--T--A--S--C--L--V--L--F--P--R--F
301    TCCTCGGCACGGCCTTCATGCTCTGGCTTCTCGATTTCTTGTGTATCCGCAAGCATTTCC    360
       --L--G--T--A--F--M--L--W--L--L--D--F--L--C--I--R--K--H--F--L
361    TGGGCCGCCGCCGCCGGGGGCAGCCCGAGCCCGAAGTGGAGCTCAACAGTGAAGGCGAGG    420
       --G--R--R--R--R--G--Q--P--E--P--E--V--E--L--N--S--E--G--E--E
421    AGGTGCCTCCCGATGACCCGCCCATCTGCGTGTCCGACGACAACCGCCTGTGCACCCTGG    480
       --V--P--P--D--D--P--P--I--C--V--S--D--D--N--R--L--C--T--L--A
481    CGTCGCTCAAGGCGGTGTGGCATGGCCAGAAGTTGGATTTCTTCAAGCAGGCGCACGAGG    540
       --S--L--K--A--V--W--H--G--Q--K--L--D--F--F--K--Q--A--H--E--G
541    GCGGTCCGGCGCCCAACTCCGAGGTGGTTCTGCCCGACGGCTTCCAGAGCCAGCACATCC    600
       --G--P--A--P--N--S--E--V--V--L--P--D--G--F--Q--S--Q--H--I--L
601    TCGACTACGCGCAAGGGAACCGCCCGCTGGTTCTCAATTTCGGCAGCTGCACCTGACCAC    660
       --D--Y--A--Q--G--N--R--P--L--V--L--N--F--G--S--C--T--U--P--P
661    CGTTCATGGCGCGCATGAGCGCCTTCCAGCGCCTGGTCACTAAGTACCAGCGCGACGTCG    720
       --F--M--A--R--M--S--A--F--Q--R--L--V--T--K--Y--Q--R--D--V--D
721    ACTTCCTCATCATCTACATCGAGGAAGCGCACCCCTCCGACGGCTGGGTCACCACGGACT    780
       --F--L--I--I--Y--I--E--E--A--H--P--S--D--G--W--V--T--T--D--S
781    CTCCCTACATCATCCCACAGCACCGGAGCCTGGAGGACCGGGTCAGCGCAGCGAGGGTAC    840
       --P--Y--I--I--P--Q--H--R--S--L--E--D--R--V--S--A--A--R--V--L
841    TGCAGCAAGGTGCACCCGGCTGCGCTCTGGTCCTCGACACCATGGCCAACTCCAGCAGCT    900
       --Q--Q--G--A--P--G--C--A--L--V--L--D--T--M--A--N--S--S--S--S
901    CGGCCTATGGCGCCTACTTCGAGCGTCTCTATGTCATCCAGAGTGGCACTATTATGTACC    960
       --A--Y--G--A--Y--F--E--R--L--Y--V--I--Q--S--G--T--I--M--Y--Q
961    AGGGCGGCCGTGGCCCCGACGGCTACCAGGTCTCTGAGCTGCGCACTTGGTTGGAACGCT   1020
       --G--G--R--G--P--D--G--Y--Q--V--S--E--L--R--T--W--L--E--R--Y
1021   ATGATGAGCAACTGCACGGCGCTCGGCCCCGGAGGGTGTAAacatccaacggacaattga   1080
       --D--E--Q--L--H--G--A--R--P--R--R--V--***...................
1081   ctgaacttggtgggctgggccttcgagccttcgaagcccacgtgcaagcgcctcaaacca   1140
       ............................................................
1141   agtcacgcttggcgaggccccagtgacactgatgtgctgagccaccatttcagactgagt   1200
       ............................................................
1201   ctgcaccctcagccacatgaacaatctcccctacctccctgggactctgcttctgtaact   1260
       ............................................................
1261   gtctcattcacacctgcctggctcactggaaatcctcttttgagcgcgggatatggcttg   1320
       ............................................................
1321   cccttgtccgtgtgcccccaggactttgcctctacagcattttcttacaccccctcccca   1380
       ............................................................
1381   gcgtgccctcagccaagtgctttggcccggtgcttcccgcagctgcacagagaccttggc   1440
       ............................................................
1441   cacgcccgcgcgccctgagcgcagctgggttccaggagactctcagctcagctgagctag   1500
       ............................................................
1501   ttgcctggcacccacctgtcgcgcgcggagagggggttccctgttgcttttgtgtctgtt   1560
       ............................................................
1561   tcctgtccctggtaggggaagtgatgtcgtggatggggaggggtgggcagggtagtttcc   1620
       ............................................................
1621   cccgcttgttttgggtgcacaggagccccactgctgatgacgaactatctctaactggtc   1680
       ............................................................
1681   ttgaccacgagctagttctgaattgcaggggcctcaaagcagcacctaaaccttgagggg   1740
       ............................................................
1741   gagggtgctctgggtttccgtgaggtaaccaccttaaatgggagggaagttggggtgtct   1800
       ............................................................
1801   gctttgggaccagaggaagatagcttgagaggcattggcgaggttcgcagcgccccaggg   1860
       ............................................................
1861   agagagaaaaagctgagactcctggggaatgacgttggggtgatggagtccggggaaaga   1920
       ............................................................
1921   gaggtggggggagagcctgaggtccccaagtgaggggagtcctaggcagagctgctgatt   1980
       ............................................................
1981   gtggggctgggaggtggagggcccctgattcgaaggccatttggtgagtgttttgctgga   2040
       ............................................................
2041   aatatttcctgtatataaacttctttcaatctacaataataaaggcttgaggtaaactgc   2100
       ............................................................
2101   ttaaaaaaaaaaaaaaaaaa                                           2160
       ....................