Imprinted Gene Databases

Homo sapiens: DHCR7

7-dehydrocholesterol reductase
Species Gene Aliases Location Status Expressed Allele
Mus musculus Dhcr7 AA409147  Imprinted Maternal
Homo sapiens DHCR7 SLOS  11q13.4  Not Imprinted Biallelic
1      aatcgctgacatcatccgggggcgggcgcccctgccctgcgggtgactccgacccctggc     60
       ............................................................
61     tagagggtaggcggcgtggagcagcgcgcgcaagcgaggccaggggaaggtgggcgcagg    120
       ............................................................
121    tgaggggccgaggtgtgcgcaggactttagccggttgagaaggatcaagcaggcatttgg    180
       ............................................................
181    agcacaggtgtctagaaacttttaaggggccggttcaagaaggaaaagttcccttctgct    240
       ............................................................
241    gtgaaactatttggcaagaggctggagggcccaATGGCTGCAAAATCGCAACCCAACATT    300
       .................................M--A--A--K--S--Q--P--N--I--
301    CCCAAAGCCAAGAGTCTAGATGGCGTCACCAATGACAGAACCGCATCTCAAGGGCAGTGG    360
       P--K--A--K--S--L--D--G--V--T--N--D--R--T--A--S--Q--G--Q--W--
361    GGCCGTGCCTGGGAGGTGGACTGGTTTTCACTGGCGAGCGTCATCTTCCTACTGCTGTTC    420
       G--R--A--W--E--V--D--W--F--S--L--A--S--V--I--F--L--L--L--F--
421    GCCCCCTTCATCGTCTACTACTTCATCATGGCTTGTGACCAGTACAGCTGCGCCCTGACT    480
       A--P--F--I--V--Y--Y--F--I--M--A--C--D--Q--Y--S--C--A--L--T--
481    GGCCCTGTGGTGGACATCGTCACCGGACATGCTCGGCTCTCGGACATCTGGGCCAAGACT    540
       G--P--V--V--D--I--V--T--G--H--A--R--L--S--D--I--W--A--K--T--
541    CCACCTATAACGAGGAAAGCCGCCCAGCTCTATACCTTGTGGGTCACCTTCCAGGTGCTT    600
       P--P--I--T--R--K--A--A--Q--L--Y--T--L--W--V--T--F--Q--V--L--
601    CTGTACACGTCTCTCCCTGACTTCTGCCATAAGTTTCTACCCGGCTACGTAGGAGGCATC    660
       L--Y--T--S--L--P--D--F--C--H--K--F--L--P--G--Y--V--G--G--I--
661    CAGGAGGGGGCCGTGACTCCTGCAGGGGTTGTGAACAAGTATCAGATCAATGGCCTGCAA    720
       Q--E--G--A--V--T--P--A--G--V--V--N--K--Y--Q--I--N--G--L--Q--
721    GCCTGGCTCCTCACGCACCTGCTCTGGTTTGCAAACGCTCATCTCCTGTCCTGGTTCTCG    780
       A--W--L--L--T--H--L--L--W--F--A--N--A--H--L--L--S--W--F--S--
781    CCCACCATCATCTTCGACAACTGGATCCCACTGCTGTGGTGCGCCAACATCCTTGGCTAT    840
       P--T--I--I--F--D--N--W--I--P--L--L--W--C--A--N--I--L--G--Y--
841    GCCGTCTCCACCTTCGCCATGGTCAAGGGCTACTTCTTCCCCACCAGCGCCAGAGACTGC    900
       A--V--S--T--F--A--M--V--K--G--Y--F--F--P--T--S--A--R--D--C--
901    AAATTCACAGGCAATTTCTTTTACAACTACATGATGGGCATCGAGTTTAACCCTCGGATC    960
       K--F--T--G--N--F--F--Y--N--Y--M--M--G--I--E--F--N--P--R--I--
961    GGGAAGTGGTTTGACTTCAAGCTGTTCTTCAATGGGCGCCCCGGGATCGTCGCCTGGACC   1020
       G--K--W--F--D--F--K--L--F--F--N--G--R--P--G--I--V--A--W--T--
1021   CTCATCAACCTGTCCTTCGCAGCGAAGCAGCGGGAGCTCCACAGCCATGTGACCAATGCC   1080
       L--I--N--L--S--F--A--A--K--Q--R--E--L--H--S--H--V--T--N--A--
1081   ATGGTCCTGGTCAACGTCCTGCAGGCCATCTACGTGATTGACTTCTTCTGGAACGAAACC   1140
       M--V--L--V--N--V--L--Q--A--I--Y--V--I--D--F--F--W--N--E--T--
1141   TGGTACCTGAAGACCATTGACATCTGCCATGACCACTTCGGGTGGTACCTGGGCTGGGGC   1200
       W--Y--L--K--T--I--D--I--C--H--D--H--F--G--W--Y--L--G--W--G--
1201   GACTGTGTCTGGCTGCCTTATCTTTACACGCTGCAGGGTCTGTACTTGGTGTACCACCCC   1260
       D--C--V--W--L--P--Y--L--Y--T--L--Q--G--L--Y--L--V--Y--H--P--
1261   GTGCAGCTGTCCACCCCGCACGCCGTGGGCGTCCTGCTGCTGGGCCTGGTGGGCTACTAC   1320
       V--Q--L--S--T--P--H--A--V--G--V--L--L--L--G--L--V--G--Y--Y--
1321   ATCTTCCGGGTGGCCAACCACCAGAAGGACCTGTTCCGCCGCACGGATGGGCGCTGCCTC   1380
       I--F--R--V--A--N--H--Q--K--D--L--F--R--R--T--D--G--R--C--L--
1381   ATCTGGGGCAGGAAGCCCAAGGTCATCGAGTGCTCCTACACATCCGCCGATGGGCAGAGG   1440
       I--W--G--R--K--P--K--V--I--E--C--S--Y--T--S--A--D--G--Q--R--
1441   CACCACAGCAAGCTGCTGGTGTCGGGCTTCTGGGGCGTGGCCCGCCACTTCAACTACGTC   1500
       H--H--S--K--L--L--V--S--G--F--W--G--V--A--R--H--F--N--Y--V--
1501   GGCGACCTGATGGGCAGCCTGGCCTACTGCCTGGCCTGTGGCGGCGGCCACCTGCTGCCC   1560
       G--D--L--M--G--S--L--A--Y--C--L--A--C--G--G--G--H--L--L--P--
1561   TACTTCTACATCATCTACATGGCCATCCTGCTGACCCACCGCTGCCTCCGGGACGAGCAC   1620
       Y--F--Y--I--I--Y--M--A--I--L--L--T--H--R--C--L--R--D--E--H--
1621   CGCTGCGCCAGCAAGTACGGCCGGGACTGGGAGCGCTACACCGCCGCAGTGCCTTACCGC   1680
       R--C--A--S--K--Y--G--R--D--W--E--R--Y--T--A--A--V--P--Y--R--
1681   CTGCTGCCTGGAATCTTCTAAgggcacgccctagggagaagccctgtggggctgtcaaga   1740
       L--L--P--G--I--F--***.......................................
1741   gcgtgttctgccaggtccatgggggctggcatcccagctccaactcgaggagcctcagtt   1800
       ............................................................
1801   tcctcatctgtaaactggagagagcccagcacttggcaggtgtccagtacctaatcacgc   1860
       ............................................................
1861   tctgttccttgcttttgccttcaagggaattccgagtgtccagcactgccgtattgccag   1920
       ............................................................
1921   cacagacggattttctctaatcagtgtccctggggcaggaggatgacccagtcaccttta   1980
       ............................................................
1981   ctagtcctttggagacaatttacctgtattaggagcccaggccacgctacactctgccca   2040
       ............................................................
2041   cactggtgagcaggaggtcttcccacgccctgtcattaggctgcatttactcttgctaaa   2100
       ............................................................
2101   taaaagtgggagtggggcgtgcgcgttatccatgtattgcctttcagctctagatccccc   2160
       ............................................................
2161   tcccctgcctgctctgcagtcgtgggtggggcccgtgcgccgtttctccttggtagcgtg   2220
       ............................................................
2221   cacggtgttgaactgggacactggggagaaaggggctttcatgtcgtttccttcctgctc   2280
       ............................................................
2281   ctgctgcacagctgccaggagtgctctgcctggagtctgcagacctcagagaggtcccag   2340
       ............................................................
2341   caccggctgtggcctttcaggtgtaggcaggtgggctctgcttcccgattccctgtgagc   2400
       ............................................................
2401   gcccaccctctcgaaagaattttctgcttgccctatgactgtgcagactctggctcgagc   2460
       ............................................................
2461   aacccggggaacttcaccctcaggggcctcccacaccttctccagcgaggaggtctcagt   2520
       ............................................................
2521   cccagcctcgggagggcacctccttttctgtgctttcttccctgaggcattcttcctcat   2580
       ............................................................
2581   ccctagggtgttgtgtagaactctttttaaactctatgctccgagtagagttcatcttta   2640
       ............................................................
2641   tattaaacttcccctgttcaaataa                                      2700
       .........................