Imprinted Gene Databases

Homo sapiens: DHCR7

7-dehydrocholesterol reductase
Species Gene Aliases Location Status Expressed Allele
Homo sapiens DHCR7 SLOS  11q13.4  Not Imprinted Biallelic
Mus musculus Dhcr7 AA409147  Imprinted Maternal
1      aatcgctgacatcatccgggggcgggcgcccctgccctgcgggtgactccgacccctggc     60
61     tagagggtaggcggcgtggagcagcgcgcgcaagcgaggccaggggaaggtgggcgcagg    120
121    tgaggggccgaggtgtgcgcaggactttagccggttgagaaggatcaagcaggcatttgg    180
181    agcacaggtgtctagaaacttttaaggggccggttcaagaaggaaaagttcccttctgct    240
241    gtgaaactatttggcaagaggctggagggcccaATGGCTGCAAAATCGCAACCCAACATT    300
1681   CTGCTGCCTGGAATCTTCTAAgggcacgccctagggagaagccctgtggggctgtcaaga   1740
1741   gcgtgttctgccaggtccatgggggctggcatcccagctccaactcgaggagcctcagtt   1800
1801   tcctcatctgtaaactggagagagcccagcacttggcaggtgtccagtacctaatcacgc   1860
1861   tctgttccttgcttttgccttcaagggaattccgagtgtccagcactgccgtattgccag   1920
1921   cacagacggattttctctaatcagtgtccctggggcaggaggatgacccagtcaccttta   1980
1981   ctagtcctttggagacaatttacctgtattaggagcccaggccacgctacactctgccca   2040
2041   cactggtgagcaggaggtcttcccacgccctgtcattaggctgcatttactcttgctaaa   2100
2101   taaaagtgggagtggggcgtgcgcgttatccatgtattgcctttcagctctagatccccc   2160
2161   tcccctgcctgctctgcagtcgtgggtggggcccgtgcgccgtttctccttggtagcgtg   2220
2221   cacggtgttgaactgggacactggggagaaaggggctttcatgtcgtttccttcctgctc   2280
2281   ctgctgcacagctgccaggagtgctctgcctggagtctgcagacctcagagaggtcccag   2340
2341   caccggctgtggcctttcaggtgtaggcaggtgggctctgcttcccgattccctgtgagc   2400
2401   gcccaccctctcgaaagaattttctgcttgccctatgactgtgcagactctggctcgagc   2460
2461   aacccggggaacttcaccctcaggggcctcccacaccttctccagcgaggaggtctcagt   2520
2521   cccagcctcgggagggcacctccttttctgtgctttcttccctgaggcattcttcctcat   2580
2581   ccctagggtgttgtgtagaactctttttaaactctatgctccgagtagagttcatcttta   2640
2641   tattaaacttcccctgttcaaataa                                      2700