Imprinted Gene Databases

Homo sapiens: DDC

Dopa decarboxylase

DDC exon1a initiates from an alternative first exon in intron 1 of the canonical DDC transcript in humans as in mice. Evidence indicates DDC is also imprinted in the fetal heart of humans, but only one polymorphic sample was available for investigation. Menheniott et al. Mol Cell Biol. 2008 Jan;28(1):386-396

Species Gene Aliases Location Status Expressed Allele
Homo sapiens DDC AADC  7p12.2  Imprinted Isoform Dependent
Mus musculus Ddc Aadc  11 7.0 cM  Imprinted Paternal
1      aactgtcactgtggagaggagagagagaggacagagagcaagtcactcccggctgccttt     60
       ............................................................
61     ttcacctctgacagagcccagacaccATGAACGCAAGTGAATTCCGAAGGAGAGGGAAGG    120
       ..........................M--N--A--S--E--F--R--R--R--G--K--E
121    AGATGGTGGATTACGTGGCCAACTACATGGAAGGCATTGAGGGACGCCAGGTCTACCCTG    180
       --M--V--D--Y--V--A--N--Y--M--E--G--I--E--G--R--Q--V--Y--P--D
181    ACGTGGAGCCCGGGTACCTGCGGCCGCTGATCCCTGCCGCTGCCCCTCAGGAGCCAGACA    240
       --V--E--P--G--Y--L--R--P--L--I--P--A--A--A--P--Q--E--P--D--T
241    CGTTTGAGGACATCATCAACGACGTTGAGAAGATAATCATGCCTGGGGTGACGCACTGGC    300
       --F--E--D--I--I--N--D--V--E--K--I--I--M--P--G--V--T--H--W--H
301    ACAGCCCCTACTTCTTCGCCTACTTCCCCACTGCCAGCTCGTACCCGGCCATGCTTGCGG    360
       --S--P--Y--F--F--A--Y--F--P--T--A--S--S--Y--P--A--M--L--A--D
361    ACATGCTGTGCGGGGCCATTGGCTGCATCGGCTTCTCCTGGGCGGCAAGCCCAGCATGCA    420
       --M--L--C--G--A--I--G--C--I--G--F--S--W--A--A--S--P--A--C--T
421    CAGAGCTGGAGACTGTGATGATGGACTGGCTCGGGAAGATGCTGGAACTACCAAAGGCAT    480
       --E--L--E--T--V--M--M--D--W--L--G--K--M--L--E--L--P--K--A--F
481    TTTTGAATGAGAAAGCTGGAGAAGGGGGAGGAGTGATCCAGGGAAGTGCCAGTGAAGCCA    540
       --L--N--E--K--A--G--E--G--G--G--V--I--Q--G--S--A--S--E--A--T
541    CCCTGGTGGCCCTGCTGGCCGCTCGGACCAAAGTGATCCATCGGCTGCAGGCAGCGTCCC    600
       --L--V--A--L--L--A--A--R--T--K--V--I--H--R--L--Q--A--A--S--P
601    CAGAGCTCACACAGGCCGCTATCATGGAGAAGCTGGTGGCTTACTCATCCGATCAGGCAC    660
       --E--L--T--Q--A--A--I--M--E--K--L--V--A--Y--S--S--D--Q--A--H
661    ACTCCTCAGTGGAAAGAGCTGGGTTAATTGGTGGAGTGAAATTAAAAGCCATCCCCTCAG    720
       --S--S--V--E--R--A--G--L--I--G--G--V--K--L--K--A--I--P--S--D
721    ATGGCAACTTCGCCATGCGTGCGTCTGCCCTGCAGGAAGCCCTGGAGAGAGACAAAGCGG    780
       --G--N--F--A--M--R--A--S--A--L--Q--E--A--L--E--R--D--K--A--A
781    CTGGCCTGATTCCTTTCTTTATGGTTGCCACCCTGGGGACCACAACATGCTGCTCCTTTG    840
       --G--L--I--P--F--F--M--V--A--T--L--G--T--T--T--C--C--S--F--D
841    ACAATCTCTTAGAAGTCGGTCCTATCTGCAACAAGGAAGACATATGGCTGCACGTTGATG    900
       --N--L--L--E--V--G--P--I--C--N--K--E--D--I--W--L--H--V--D--A
901    CAGCCTACGCAGGCAGTGCATTCATCTGCCCTGAGTTCCGGCACCTTCTGAATGGAGTGG    960
       --A--Y--A--G--S--A--F--I--C--P--E--F--R--H--L--L--N--G--V--E
961    AGTTTGCAGATTCATTCAACTTTAATCCCCACAAATGGCTATTGGTGAATTTTGACTGTT   1020
       --F--A--D--S--F--N--F--N--P--H--K--W--L--L--V--N--F--D--C--S
1021   CTGCCATGTGGGTGAAAAAGAGAACAGACTTAACGGGAGCCTTTAGACTGGACCCCACTT   1080
       --A--M--W--V--K--K--R--T--D--L--T--G--A--F--R--L--D--P--T--Y
1081   ACCTGAAGCACAGCCATCAGGATTCAGGGCTTATCACTGACTACCGGCATTGGCAGATAC   1140
       --L--K--H--S--H--Q--D--S--G--L--I--T--D--Y--R--H--W--Q--I--P
1141   CACTGGGCAGAAGATTTCGCTCTTTGAAAATGTGGTTTGTATTTAGGATGTATGGAGTCA   1200
       --L--G--R--R--F--R--S--L--K--M--W--F--V--F--R--M--Y--G--V--K
1201   AAGGACTGCAGGCTTATATCCGCAAGCATGTCCAGCTGTCCCATGAGTTTGAGTCACTGG   1260
       --G--L--Q--A--Y--I--R--K--H--V--Q--L--S--H--E--F--E--S--L--V
1261   TGCGCCAGGATCCCCGCTTTGAAATCTGTGTGGAAGTCATTCTGGGGCTTGTCTGCTTTC   1320
       --R--Q--D--P--R--F--E--I--C--V--E--V--I--L--G--L--V--C--F--R
1321   GGCTAAAGGGTTCCAACAAAGTGAATGAAGCTCTTCTGCAAAGAATAAACAGTGCCAAAA   1380
       --L--K--G--S--N--K--V--N--E--A--L--L--Q--R--I--N--S--A--K--K
1381   AAATCCACTTGGTTCCATGTCACCTCAGGGACAAGTTTGTCCTGCGCTTTGCCATCTGTT   1440
       --I--H--L--V--P--C--H--L--R--D--K--F--V--L--R--F--A--I--C--S
1441   CTCGCACGGTGGAATCTGCCCATGTGCAGCGGGCCTGGGAACACATCAAAGAGCTGGCGG   1500
       --R--T--V--E--S--A--H--V--Q--R--A--W--E--H--I--K--E--L--A--A
1501   CCGACGTGCTGCGAGCAGAGAGGGAGTAGgagtgaagccagctgcaggaatcaaaaattg   1560
       --D--V--L--R--A--E--R--E--***...............................
1561   aagagagatatatctgaaaactggaataagaagcaaataaatatcatcctgccttcatgg   1620
       ............................................................
1621   aactcagctgtctgtggcttcccatgtctttctccaaagttatccagagggttgtgattt   1680
       ............................................................
1681   tgtctgcttagtatctcatcaacaaagaaatattatttgctaattaaaaagttaatcttc   1740
       ............................................................
1741   atggccatagcttttattcattagctgtgatttttgttgattaaaacattatagattttc   1800
       ............................................................
1801   atgttcttgcagtcatcagaagtggtaggaaagcctcactgatatattttccagggcaat   1860
       ............................................................
1861   caatgttcacgcaacttgaaattatatctgtggtcttcaaattgtcttttgtcatgtggc   1920
       ............................................................
1921   taaatgcctaataaacaattcaagtgaaatactaaaaaaaaaaaaaaaaaaaaaa        1980
       .......................................................