Imprinted Gene Databases

Homo sapiens: DCN

Decorin
Species Gene Aliases Location Status Expressed Allele
Sus scrofa DCN   Not Imprinted Biallelic
Bos taurus DCN   Not Imprinted Biallelic
Homo sapiens DCN CSCD, PG40, PGII, PGS2, DSPG2, SLRR1B  12q21.33  Unknown Unknown
Mus musculus Dcn DC, PG40, PGII, PGS2, mDcn, DSPG2, SLRR1B  10 55.0 cM  Imprinted Maternal
1      gaatctacaataagacaaatttcaaatcaagttgctccactatactgcataagcagttta     60
       ............................................................
61     gaatcttaagcagatgcaaaaagaataaagcaaatgggaggaaaaaaaaggccgataaag    120
       ............................................................
121    tttctggctacaatacaagagacatatcattaccatatgatctaatgtgggtgtcagccg    180
       ............................................................
181    gattgtgttcattgagggaaaccttattttttaactgtgctatggagtagaagcaggagg    240
       ............................................................
241    ttttcaacctagtcacagagcagcacctaccccctcctcctttccacacctgcaaactct    300
       ............................................................
301    tttacttgggctgaatatttagtgtaattacatctcagctttgagggctcctgtggcaaa    360
       ............................................................
361    ttcccggattaaaaggttccctggttgtgaaaatacatgagataaatcATGAAGGCCACT    420
       ................................................M--K--A--T--
421    ATCATCCTCCTTCTGCTTGCACAAGTTTCCTGGGCTGGACCGTTTCAACAGAGAGGCTTA    480
       I--I--L--L--L--L--A--Q--V--S--W--A--G--P--F--Q--Q--R--G--L--
481    TTTGACTTTATGCTAGAAGATGAGGCTTCTGGGATAGGCCCAGAAGTTCCTGATGACCGC    540
       F--D--F--M--L--E--D--E--A--S--G--I--G--P--E--V--P--D--D--R--
541    GACTTCGAGCCCTCCCTAGGCCCAGTGTGCCCCTTCCGCTGTCAATGCCATCTTCGAGTG    600
       D--F--E--P--S--L--G--P--V--C--P--F--R--C--Q--C--H--L--R--V--
601    GTCCAGTGTTCTGATTTGGGTCTGGACAAAGTGCCAAAGGATCTTCCCCCTGACACAACT    660
       V--Q--C--S--D--L--G--L--D--K--V--P--K--D--L--P--P--D--T--T--
661    CTGCTAGACCTGCAAAACAACAAAATAACCGAAATCAAAGATGGAGACTTTAAGAACCTG    720
       L--L--D--L--Q--N--N--K--I--T--E--I--K--D--G--D--F--K--N--L--
721    AAGAACCTTCACGCATTGATTCTTGTCAACAATAAAATTAGCAAAGTTAGTCCTGGAGCA    780
       K--N--L--H--A--L--I--L--V--N--N--K--I--S--K--V--S--P--G--A--
781    TTTACACCTTTGGTGAAGTTGGAACGACTTTATCTGTCCAAGAATCAGCTGAAGGAATTG    840
       F--T--P--L--V--K--L--E--R--L--Y--L--S--K--N--Q--L--K--E--L--
841    CCAGAAAAAATGCCCAAAACTCTTCAGGAGCTGCGTGCCCATGAGAATGAGATCACCAAA    900
       P--E--K--M--P--K--T--L--Q--E--L--R--A--H--E--N--E--I--T--K--
901    GTGCGAAAAGTTACTTTCAATGGACTGAACCAGATGATTGTCATAGAACTGGGCACCAAT    960
       V--R--K--V--T--F--N--G--L--N--Q--M--I--V--I--E--L--G--T--N--
961    CCGCTGAAGAGCTCAGGAATTGAAAATGGGGCTTTCCAGGGAATGAAGAAGCTCTCCTAC   1020
       P--L--K--S--S--G--I--E--N--G--A--F--Q--G--M--K--K--L--S--Y--
1021   ATCCGCATTGCTGATACCAATATCACCAGCATTCCTCAAGGTCTTCCTCCTTCCCTTACG   1080
       I--R--I--A--D--T--N--I--T--S--I--P--Q--G--L--P--P--S--L--T--
1081   GAATTACATCTTGATGGCAACAAAATCAGCAGAGTTGATGCAGCTAGCCTGAAAGGACTG   1140
       E--L--H--L--D--G--N--K--I--S--R--V--D--A--A--S--L--K--G--L--
1141   AATAATTTGGCTAAGTTGGGATTGAGTTTCAACAGCATCTCTGCTGTTGACAATGGCTCT   1200
       N--N--L--A--K--L--G--L--S--F--N--S--I--S--A--V--D--N--G--S--
1201   CTGGCCAACACGCCTCATCTGAGGGAGCTTCACTTGGACAACAACAAGCTTACCAGAGTA   1260
       L--A--N--T--P--H--L--R--E--L--H--L--D--N--N--K--L--T--R--V--
1261   CCTGGTGGGCTGGCAGAGCATAAGTACATCCAGGTTGTCTACCTTCATAACAACAATATC   1320
       P--G--G--L--A--E--H--K--Y--I--Q--V--V--Y--L--H--N--N--N--I--
1321   TCTGTAGTTGGATCAAGTGACTTCTGCCCACCTGGACACAACACCAAAAAGGCTTCTTAT   1380
       S--V--V--G--S--S--D--F--C--P--P--G--H--N--T--K--K--A--S--Y--
1381   TCGGGTGTGAGTCTTTTCAGCAACCCGGTCCAGTACTGGGAGATACAGCCATCCACCTTC   1440
       S--G--V--S--L--F--S--N--P--V--Q--Y--W--E--I--Q--P--S--T--F--
1441   AGATGTGTCTACGTGCGCTCTGCCATTCAACTCGGAAACTATAAGTAAttctcaagaaag   1500
       R--C--V--Y--V--R--S--A--I--Q--L--G--N--Y--K--***............
1501   ccctcatttttataacctggcaaaatcttgttaatgtcattgctaaaaaataaataaaag   1560
       ............................................................
1561   ctagatactggaaacctaactgcaatgtggatgttttacccacatgacttattatgcata   1620
       ............................................................
1621   aagccaaatttccagtttaagtaattgcctacaataaaaagaaattttgcctgccatttt   1680
       ............................................................
1681   cagaatcatcttttgaagctttctgttgatgttaactgagctactagagatattcttatt   1740
       ............................................................
1741   tcactaaatgtaaaatttggagtaaatatatatgtcaatatttagtaaagcttttctttt   1800
       ............................................................
1801   ttaatttccaggaaaaaataaaaagagtatgagtcttctgtaattcattgagcagttagc   1860
       ............................................................
1861   tcatttgagataaagtcaaatgccaaacactagctctgtattaatccccatcattactgg   1920
       ............................................................
1921   taaagcctcatttgaatgtgtgaattcaatacaggctatgtaaaatttttactaatgtca   1980
       ............................................................
1981   ttattttgaaaaaataaatttaaaaatacattcaaaattactattgtatacaagcttaat   2040
       ............................................................
2041   tgttaatattccctaaacacaattttatgaagggagaagacattggtttgttgacaataa   2100
       ............................................................
2101   cagtacatcttttcaagttctcagctatttcttctacctctccctatcttacatttgagt   2160
       ............................................................
2161   atggtaacttatgtcatctatgttgaatgtaagcttataaagcacaaagcatacatttcc   2220
       ............................................................
2221   tgactggtctagagaactgatgtttcaatttacccctctgctaaataaatattaaaacta   2280
       ............................................................
2281   tcatgtgaaaaaaaaaaaaaaaaaa                                      2340
       .........................