Imprinted Gene Databases

Homo sapiens: CTNNA3

Catenin, alpha 3
Species Gene Aliases Location Status Expressed Allele
Homo sapiens CTNNA3 VR22, MGC26194, MGC75041  10q22.2  Provisional Data Maternal
Mus musculus Ctnna3 Vr22, Catna3, 4933408A16  10 B4-B5.1  Unknown Unknown
1      tttctttcttatcctgggtgaacaacgctcagcgaaattgactgccccactgtcatctgc     60
       ............................................................
61     ctctcaatttggtactctgtaactctgtgaccaccaagaagcctttttccgtcccccaca    120
       ............................................................
121    aagctctttttggaaaattccctacgggagctgaattttaagcccatttactttatagga    180
       ............................................................
181    agaaacagaaaggcagcATGTCAGCTGAAACACCAATCACATTGAATATCGATCCTCAGG    240
       .................M--S--A--E--T--P--I--T--L--N--I--D--P--Q--D
241    ATCTGCAGGTCCAAACATTCACCGTGGAGAAGCTACTGGAGCCTCTCATAATCCAGGTTA    300
       --L--Q--V--Q--T--F--T--V--E--K--L--L--E--P--L--I--I--Q--V--T
301    CCACACTTGTAAACTGTCCCCAGAACCCTTCCAGCAGGAAAAAAGGACGTTCGAAAAGAG    360
       --T--L--V--N--C--P--Q--N--P--S--S--R--K--K--G--R--S--K--R--A
361    CCAGTGTCCTTCTAGCTTCTGTGGAGGAAGCAACTTGGAATTTATTAGACAAGGGAGAGA    420
       --S--V--L--L--A--S--V--E--E--A--T--W--N--L--L--D--K--G--E--K
421    AGATTGCCCAGGAAGCTACAGTTTTAAAGGATGAGCTTACGGCTTCACTTGAGGAAGTTC    480
       --I--A--Q--E--A--T--V--L--K--D--E--L--T--A--S--L--E--E--V--R
481    GCAAAGAAAGTGAAGCTCTGAAAGTATCAGCTGAGAGATTTACAGATGACCCCTGTTTTC    540
       --K--E--S--E--A--L--K--V--S--A--E--R--F--T--D--D--P--C--F--L
541    TCCCAAAAAGGGAGGCTGTGGTTCAAGCTGCCCGTGCCTTGCTGGCTGCGGTGACGAGAC    600
       --P--K--R--E--A--V--V--Q--A--A--R--A--L--L--A--A--V--T--R--L
601    TCCTTATCCTTGCGGACATGATTGATGTCATGTGCCTCTTGCAACATGTGTCAGCTTTTC    660
       --L--I--L--A--D--M--I--D--V--M--C--L--L--Q--H--V--S--A--F--Q
661    AAAGGACATTTGAGTCTCTCAAAAATGTTGCCAACAAATCTGACCTCCAGAAAACCTACC    720
       --R--T--F--E--S--L--K--N--V--A--N--K--S--D--L--Q--K--T--Y--Q
721    AGAAGCTTGGGAAGGAGCTGGAAAATTTGGATTATTTAGCCTTCAAACGTCAGCAGGACT    780
       --K--L--G--K--E--L--E--N--L--D--Y--L--A--F--K--R--Q--Q--D--L
781    TAAAATCTCCAAATCAGAGAGATGAAATTGCAGGAGCCCGAGCTTCACTGAAGGAGAACT    840
       --K--S--P--N--Q--R--D--E--I--A--G--A--R--A--S--L--K--E--N--S
841    CTCCCCTCTTGCATTCAATTTGTTCAGCTTGTTTGGAGCATTCTGATGTTGCTTCCCTCA    900
       --P--L--L--H--S--I--C--S--A--C--L--E--H--S--D--V--A--S--L--K
901    AAGCAAGCAAGGACACAGTTTGTGAAGAAATTCAGAATGCTCTCAATGTAATTTCAAATG    960
       --A--S--K--D--T--V--C--E--E--I--Q--N--A--L--N--V--I--S--N--A
961    CTTCACAAGGGATCCAGAATATGACAACCCCACCAGAACCTCAGGCAGCAACCCTGGGAA   1020
       --S--Q--G--I--Q--N--M--T--T--P--P--E--P--Q--A--A--T--L--G--S
1021   GTGCCCTTGATGAGCTGGAGAATTTAATTGTCCTGAATCCACTCACAGTAACTGAGGAGG   1080
       --A--L--D--E--L--E--N--L--I--V--L--N--P--L--T--V--T--E--E--E
1081   AAATACGACCATCACTAGAGAAACGCCTTGAAGCCATTATCAGTGGGGCTGCTCTGCTGG   1140
       --I--R--P--S--L--E--K--R--L--E--A--I--I--S--G--A--A--L--L--A
1141   CGGATTCTTCATGTACGAGGGACTTACACCGAGAGCGGATTATCGCAGAATGCAACGCCA   1200
       --D--S--S--C--T--R--D--L--H--R--E--R--I--I--A--E--C--N--A--I
1201   TTCGCCAGGCTCTTCAGGATCTGCTTTCAGAGTACATGAACAACGCTGGAAAAAAAGAAA   1260
       --R--Q--A--L--Q--D--L--L--S--E--Y--M--N--N--A--G--K--K--E--R
1261   GGAGTAATACCCTGAATATTGCTTTAGACAACATGTGTAAGAAGACAAGAGACCTTCGCA   1320
       --S--N--T--L--N--I--A--L--D--N--M--C--K--K--T--R--D--L--R--R
1321   GACAGCTCCGCAAGGCTATTATAGATCATGTGTCAGACTCTTTCCTGGATACGACAGTCC   1380
       --Q--L--R--K--A--I--I--D--H--V--S--D--S--F--L--D--T--T--V--P
1381   CTCTTTTGGTTCTCATTGAAGCTGCTAAGAATGGCCGGGAAAAGGAAATAAAAGAATATG   1440
       --L--L--V--L--I--E--A--A--K--N--G--R--E--K--E--I--K--E--Y--A
1441   CTGCGATATTTCATGAACACACCAGCAGGCTTGTAGAGGTGGCAAATCTTGCTTGTTCCA   1500
       --A--I--F--H--E--H--T--S--R--L--V--E--V--A--N--L--A--C--S--M
1501   TGTCAACAAATGAAGATGGAATTAAAATTGTCAAAATTGCAGCCAATCATTTGGAAACCT   1560
       --S--T--N--E--D--G--I--K--I--V--K--I--A--A--N--H--L--E--T--L
1561   TGTGTCCACAGATTATTAATGCTGCACTTGCTTTGGCTGCAAGACCCAAAAGTCAAGCGG   1620
       --C--P--Q--I--I--N--A--A--L--A--L--A--A--R--P--K--S--Q--A--V
1621   TCAAAAACACCATGGAAATGTACAAGCGTACATGGGAGAATCATATACATGTCCTCACTG   1680
       --K--N--T--M--E--M--Y--K--R--T--W--E--N--H--I--H--V--L--T--E
1681   AAGCCGTAGATGACATTACAAGCATTGATGACTTCCTTGCTGTATCTGAAAGCCATATCT   1740
       --A--V--D--D--I--T--S--I--D--D--F--L--A--V--S--E--S--H--I--L
1741   TGGAAGATGTCAACAAGTGTATCATAGCCTTAAGAGACCAGGATGCTGATAATTTAGACC   1800
       --E--D--V--N--K--C--I--I--A--L--R--D--Q--D--A--D--N--L--D--R
1801   GTGCTGCGGGTGCTATCAGAGGCCGGGCAGCAAGAGTTGCTCACATCGTCACGGGTGAAA   1860
       --A--A--G--A--I--R--G--R--A--A--R--V--A--H--I--V--T--G--E--M
1861   TGGACAGTTACGAGCCAGGGGCTTACACGGAAGGTGTAATGAGAAATGTTAACTTCCTTA   1920
       --D--S--Y--E--P--G--A--Y--T--E--G--V--M--R--N--V--N--F--L--T
1921   CAAGTACTGTAATTCCTGAATTTGTAACACAAGTGAATGTTGCCTTGGAAGCCTTAAGCA   1980
       --S--T--V--I--P--E--F--V--T--Q--V--N--V--A--L--E--A--L--S--K
1981   AAAGCTCATTGAATGTGTTGGATGATAATCAATTTGTGGACATCTCAAAGAAGATCTATG   2040
       --S--S--L--N--V--L--D--D--N--Q--F--V--D--I--S--K--K--I--Y--D
2041   ATACAATTCATGATATCAGATGTTCAGTCATGATGATTCGGACCCCAGAGGAACTGGAGG   2100
       --T--I--H--D--I--R--C--S--V--M--M--I--R--T--P--E--E--L--E--D
2101   ATGTTTCTGACCTTGAAGAGGAACACGAGGTCCGCAGTCACACCAGCATTCAGACCGAAG   2160
       --V--S--D--L--E--E--E--H--E--V--R--S--H--T--S--I--Q--T--E--G
2161   GGAAAACTGATAGGGCTAAGATGACTCAACTGCCTGAGGCAGAAAAAGAAAAGATTGCTG   2220
       --K--T--D--R--A--K--M--T--Q--L--P--E--A--E--K--E--K--I--A--E
2221   AGCAAGTTGCTGATTTCAAGAAAGTAAAGAGTAAGCTGGATGCTGAGATTGAGATATGGG   2280
       --Q--V--A--D--F--K--K--V--K--S--K--L--D--A--E--I--E--I--W--D
2281   ATGATACAAGCAACGACATCATTGTTCTGGCCAAGAACATGTGTATGATCATGATGGAGA   2340
       --D--T--S--N--D--I--I--V--L--A--K--N--M--C--M--I--M--M--E--M
2341   TGACAGACTTCACTAGGGGCAAAGGACCACTAAAGCATACAACTGATGTGATCTATGCAG   2400
       --T--D--F--T--R--G--K--G--P--L--K--H--T--T--D--V--I--Y--A--A
2401   CGAAAATGATATCAGAATCAGGATCAAGGATGGATGTCCTTGCTCGGCAGATTGCTAATC   2460
       --K--M--I--S--E--S--G--S--R--M--D--V--L--A--R--Q--I--A--N--Q
2461   AGTGCCCAGATCCATCTTGTAAACAGGACTTGTTGGCCTACCTGGAACAGATTAAGTTCT   2520
       --C--P--D--P--S--C--K--Q--D--L--L--A--Y--L--E--Q--I--K--F--Y
2521   ACTCCCACCAACTGAAAATCTGCAGTCAAGTTAAAGCTGAGATCCAGAACCTGGGAGGAG   2580
       --S--H--Q--L--K--I--C--S--Q--V--K--A--E--I--Q--N--L--G--G--E
2581   AGCTCATCATGTCAGCTTTGGACAGTGTCACATCCCTGATCCAAGCAGCCAAAAATTTAA   2640
       --L--I--M--S--A--L--D--S--V--T--S--L--I--Q--A--A--K--N--L--M
2641   TGAATGCTGTAGTGCAAACAGTGAAAATGTCTTACATTGCCTCAACCAAGATCATCCGAA   2700
       --N--A--V--V--Q--T--V--K--M--S--Y--I--A--S--T--K--I--I--R--I
2701   TCCAGAGTCCTGCTGGGCCCCGGCACCCAGTTGTGATGTGGAGAATGAAGGCTCCTGCAA   2760
       --Q--S--P--A--G--P--R--H--P--V--V--M--W--R--M--K--A--P--A--K
2761   AAAAACCCTTGATTAAAAGAGAGAAGCCAGAGGAAACGTGTGCAGCTGTCAGACGAGGCT   2820
       --K--P--L--I--K--R--E--K--P--E--E--T--C--A--A--V--R--R--G--S
2821   CAGCAAAGAAAAAAATCCATCCATTGCAAGTCATGAGTGAATTTAGAGGAAGACAAATCT   2880
       --A--K--K--K--I--H--P--L--Q--V--M--S--E--F--R--G--R--Q--I--Y
2881   ACTGAaaccactattctacatatagtgcctatatgacaaaatcctgcctaaccacactgc   2940
       --***.......................................................
2941   tttattttacacttaagaagttctgtaatttcactaagttttggtgtttaactcacaaat   3000
       ............................................................
3001   aacataaaatattgggcgctaaatcaacaaaagcaatatatatttgggatcatatcactg   3060
       ............................................................
3061   tcatttctgtatggtcagcacctaatagttaaggaatatttgcttgttgaatgaatgaaa   3120
       ............................................................
3121   ttatcacgtgtcattcagcgtttcccatcatagagattatctactattcgttaccaaata   3180
       ............................................................
3181   aacacaggagaggccagagagtcctgtttatctgtaatacttcatgtacacttatcatcc   3240
       ............................................................
3241   ttatcttg                                                       3300
       ........