Imprinted Gene Databases

Homo sapiens: COPG2

Coatomer protein complex, subunit gamma 2
Species Gene Aliases Location Status Expressed Allele
Homo sapiens COPG2 2-COP, FLJ11781, DKFZp761N09121  7q32  Conflicting Data Paternal
Bos taurus COPG2   Not Imprinted Biallelic
Monodelphis domestica COPG2     Not Imprinted Biallelic
Mus musculus Copg2 AW227625  6 A3.3  Imprinted Maternal
1      cggggccggccttcctgcagcctcttccgctcgccggctgcggcgcctgggacggttgcg     60
       ............................................................
61     gtgggtctgggcgctgggaagtcgtccaagATGATTAAAAAATTCGACAAGAAGGACGAG    120
       ..............................M--I--K--K--F--D--K--K--D--E--
121    GAGTCTGGTAGTGGCTCCAATCCTTTCCAGCATCTGGAGAAGAGTGCTGTTTTACAGGAG    180
       E--S--G--S--G--S--N--P--F--Q--H--L--E--K--S--A--V--L--Q--E--
181    GCTCGTATATTCAATGAAACTCCAATCAATCCAAGAAGATGTTTGCATATTCTTACAAAG    240
       A--R--I--F--N--E--T--P--I--N--P--R--R--C--L--H--I--L--T--K--
241    ATTCTTTACTTACTGAACCAGGGTGAACACTTTGGAACAACGGAAGCTACAGAAGCCTTC    300
       I--L--Y--L--L--N--Q--G--E--H--F--G--T--T--E--A--T--E--A--F--
301    TTTGCAATGACGCGATTGTTTCAATCTAATGATCAAACATTGAGGAGAATGTGCTACCTT    360
       F--A--M--T--R--L--F--Q--S--N--D--Q--T--L--R--R--M--C--Y--L--
361    ACCATCAAAGAAATGGCTACCATCTCTGAGGATGTGATAATTGTCACAAGCAGTCTGACT    420
       T--I--K--E--M--A--T--I--S--E--D--V--I--I--V--T--S--S--L--T--
421    AAAGACATGACTGGAAAAGAAGATGTATACCGAGGCCCGGCCATCAGAGCTCTCTGCAGG    480
       K--D--M--T--G--K--E--D--V--Y--R--G--P--A--I--R--A--L--C--R--
481    ATCACCGATGGAACAATGTTGCAAGCCATTGAAAGATACATGAAGCAGGCCATTGTGGAT    540
       I--T--D--G--T--M--L--Q--A--I--E--R--Y--M--K--Q--A--I--V--D--
541    AAAGTTTCCAGTGTATCCAGTTCAGCACTGGTATCTTCCCTGCACATGATGAAGATAAGC    600
       K--V--S--S--V--S--S--S--A--L--V--S--S--L--H--M--M--K--I--S--
601    TATGATGTGGTTAAGCGCTGGATCAATGAAGCCCAAGAAGCTGCATCAAGTGATAATATT    660
       Y--D--V--V--K--R--W--I--N--E--A--Q--E--A--A--S--S--D--N--I--
661    ATGGTCCAGTACCATGCATTGGGAGTCCTGTATCACCTTAGAAAGAATGATCGACTTGCT    720
       M--V--Q--Y--H--A--L--G--V--L--Y--H--L--R--K--N--D--R--L--A--
721    GTTTCCAAGATGTTGAATAAGTTTACTAAATCTGGTCTCAAGTCACAGTTTGCTTACTGC    780
       V--S--K--M--L--N--K--F--T--K--S--G--L--K--S--Q--F--A--Y--C--
781    ATGCTGATCCGAATTGCCAGTCGCTTACTAAAAGAAACTGAGGATGGCCATGAAAGTCCA    840
       M--L--I--R--I--A--S--R--L--L--K--E--T--E--D--G--H--E--S--P--
841    CTGTTTGATTTCATTGAGAGCTGCTTGCGAAATAAACATGAAATGGTTATTTATGAAGCT    900
       L--F--D--F--I--E--S--C--L--R--N--K--H--E--M--V--I--Y--E--A--
901    GCTTCAGCTATCATCCATCTTCCTAACTGCACTGCAAGAGAGTTGGCACCTGCTGTTTCA    960
       A--S--A--I--I--H--L--P--N--C--T--A--R--E--L--A--P--A--V--S--
961    GTTCTTCAACTTTTCTGTAGTTCTCCTAAGCCAGCCTTGAGATATGCAGCTGTGAGGACC   1020
       V--L--Q--L--F--C--S--S--P--K--P--A--L--R--Y--A--A--V--R--T--
1021   TTGAACAAGGTGGCAATGAAGCACCCCTCTGCTGTTACTGCCTGCAATCTGGACTTAGAA   1080
       L--N--K--V--A--M--K--H--P--S--A--V--T--A--C--N--L--D--L--E--
1081   AACTTAATCACAGACTCAAACAGAAGCATTGCTACCTTAGCCATTACTACACTCCTCAAA   1140
       N--L--I--T--D--S--N--R--S--I--A--T--L--A--I--T--T--L--L--K--
1141   ACAGGAAGTGAGAGCAGTGTGGACCGGCTCATGAAGCAGATATCTTCTTTTGTGTCTGAA   1200
       T--G--S--E--S--S--V--D--R--L--M--K--Q--I--S--S--F--V--S--E--
1201   ATCTCAGATGAGTTCAAGGTGGTGGTTGTACAGGCAATTAGTGCTCTCTGTCAGAAATAC   1260
       I--S--D--E--F--K--V--V--V--V--Q--A--I--S--A--L--C--Q--K--Y--
1261   CCTCGAAAGCACAGTGTCATGATGACTTTCCTCTCCAACATGCTCCGAGATGATGGAGGC   1320
       P--R--K--H--S--V--M--M--T--F--L--S--N--M--L--R--D--D--G--G--
1321   TTTGAGTACAAGCGGGCCATTGTGGACTGTATAATCAGCATTGTGGAAGAGAACCCTGAG   1380
       F--E--Y--K--R--A--I--V--D--C--I--I--S--I--V--E--E--N--P--E--
1381   AGTAAAGAAGCAGGCCTAGCCCACCTTTGTGAATTCATTGAGGACTGTGAACACACTGTT   1440
       S--K--E--A--G--L--A--H--L--C--E--F--I--E--D--C--E--H--T--V--
1441   CTGGCTACTAAGATTCTACACTTGTTGGGCAAAGAGGGCCCTAGAACGCCTGTCCCCTCC   1500
       L--A--T--K--I--L--H--L--L--G--K--E--G--P--R--T--P--V--P--S--
1501   AAATATATCCGTTTTATTTTTAATAGGGTTGTCCTGGAGAATGAGGCTGTCAGAGCTGCT   1560
       K--Y--I--R--F--I--F--N--R--V--V--L--E--N--E--A--V--R--A--A--
1561   GCTGTGAGTGCTTTGGCTAAATTTGGGGCTCAGAATGAGAGTCTTCTCCCAAGCATCCTT   1620
       A--V--S--A--L--A--K--F--G--A--Q--N--E--S--L--L--P--S--I--L--
1621   GTACTCTTACAGAGGTGTATGATGGATACTGATGACGAGGTACGAGACAGAGCTACCTTC   1680
       V--L--L--Q--R--C--M--M--D--T--D--D--E--V--R--D--R--A--T--F--
1681   TATCTGAATGTGCTGCAGCAGAGGCAGATGGCACTAAATGCCACATATATCTTTAATGGT   1740
       Y--L--N--V--L--Q--Q--R--Q--M--A--L--N--A--T--Y--I--F--N--G--
1741   TTGACGGTCTCTGTACCAGGGATGGAAAAAGCCTTACACCAGTACACGTTGGAGCCTTCA   1800
       L--T--V--S--V--P--G--M--E--K--A--L--H--Q--Y--T--L--E--P--S--
1801   GAAAAACCGTTTGACATGAAATCAATTCCTCTTGCTATGGCTCCTGTCTTTGAACAGAAA   1860
       E--K--P--F--D--M--K--S--I--P--L--A--M--A--P--V--F--E--Q--K--
1861   GCAGAAATCACACTTGTGGCTACTAAGCCAGAGAAGTTGGCTCCTTCCAGGCAAGACATT   1920
       A--E--I--T--L--V--A--T--K--P--E--K--L--A--P--S--R--Q--D--I--
1921   TTCCAAGAACAATTGGCTGCCATTCCTGAGTTTCTGAATATAGGACCCTTGTTCAAGTCT   1980
       F--Q--E--Q--L--A--A--I--P--E--F--L--N--I--G--P--L--F--K--S--
1981   TCTGAGCCTGTTCAACTTACAGAAGCAGAGACAGAATATTTTGTTCGATGTATCAAGCAC   2040
       S--E--P--V--Q--L--T--E--A--E--T--E--Y--F--V--R--C--I--K--H--
2041   ATGTTTACCAATCACATCGTGTTCCAGTTTGACTGCACCAACACTCTCAATGACCAGCTG   2100
       M--F--T--N--H--I--V--F--Q--F--D--C--T--N--T--L--N--D--Q--L--
2101   CTGGAAAAAGTGACAGTGCAGATGGAGCCATCAGATTCCTATGAAGTGCTGTCTTGTATC   2160
       L--E--K--V--T--V--Q--M--E--P--S--D--S--Y--E--V--L--S--C--I--
2161   CCAGCCCCCAGCCTTCCTTATAACCAACCAGGAATATGTTACACTCTTGTTCGTTTGCCT   2220
       P--A--P--S--L--P--Y--N--Q--P--G--I--C--Y--T--L--V--R--L--P--
2221   GATGATGACCCTACAGCAGTTGCAGGCTCCTTTAGCTGCACCATGAAGTTTACAGTCCGG   2280
       D--D--D--P--T--A--V--A--G--S--F--S--C--T--M--K--F--T--V--R--
2281   GACTGTGACCCTAACACTGGAGTTCCAGATGAGGATGGGTATGATGATGAGTATGTGCTG   2340
       D--C--D--P--N--T--G--V--P--D--E--D--G--Y--D--D--E--Y--V--L--
2341   GAAGATCTCGAAGTGACTGTGTCTGACCATATTCAGAAAGTACTGAAGCCTAACTTTGCT   2400
       E--D--L--E--V--T--V--S--D--H--I--Q--K--V--L--K--P--N--F--A--
2401   GCTGCTTGGGAAGAGGTGGGAGATACCTTTGAGAAAGAGGAAACCTTTGCCCTCAGTTCT   2460
       A--A--W--E--E--V--G--D--T--F--E--K--E--E--T--F--A--L--S--S--
2461   ACCAAAACCCTTGAAGAGGCTGTCAACAATATCATCACATTTCTGGGCATGCAGCCATGT   2520
       T--K--T--L--E--E--A--V--N--N--I--I--T--F--L--G--M--Q--P--C--
2521   GAGAGGTCCGATAAAGTACCTGAGAACAAGAATTCCCATTCGCTCTATCTGGCAGGTATA   2580
       E--R--S--D--K--V--P--E--N--K--N--S--H--S--L--Y--L--A--G--I--
2581   TTCAGAGGTGGCTATGATTTATTGGTGAGGTCCAGGCTGGCCTTAGCCGATGGAGTGACC   2640
       F--R--G--G--Y--D--L--L--V--R--S--R--L--A--L--A--D--G--V--T--
2641   ATGCAGGTGACTGTCAGAAGTAAAGAGAGAACACCTGTAGATGTTATCTTAGCTTCTGTT   2700
       M--Q--V--T--V--R--S--K--E--R--T--P--V--D--V--I--L--A--S--V--
2701   GGATAAatgcttactggacaagaggaaactgatgcacactacatggtcagtgggctttta   2760
       G--***......................................................
2761   ggctagtggcatcagtttcccagaatcagacttttgaagatgaatgactttggagaagca   2820
       ............................................................
2821   aattaaacatttggccctgagccagcagatcaagcaaatgtctatctttgcgcatgggtt   2880
       ............................................................
2881   gttttttttttttttctttttattctacttggtcagctttgggacgatagtgcagctttg   2940
       ............................................................
2941   ggtgatcttgaaaatcaaatactatcctatactccagctgcttaacttcattttattctt   3000
       ............................................................
3001   taatgtgtacctgaaagctcctggcaatgctggaaaatttttatcccagaggggtggggg   3060
       ............................................................
3061   ggaggggggaggggaagccagagtccacttttgtcacaattcatttttattaatagaaaa   3120
       ............................................................
3121   taaacacttattccagtttcaaaaaaaaaaaaaa                             3180
       ..................................