Imprinted Gene Databases

Homo sapiens: COMMD1

Copper metabolism domain containing 1
Species Gene Aliases Location Status Expressed Allele
Homo sapiens COMMD1 MURR1, C2orf5, MGC27155  2p15  Not Imprinted Biallelic
Sus scrofa COMMD1   Not Imprinted Biallelic
Mus musculus Commd1 Murr1, U2/Mu, AI256843  11 12.0 cM  Imprinted Maternal
1      cttcgcagagcATGGCGGCGGGCGAGCTTGAGGGTGGCAAACCCCTGAGCGGGCTGCTGA     60
       ...........M--A--A--G--E--L--E--G--G--K--P--L--S--G--L--L--N
61     ATGCGCTGGCCCAGGACACTTTCCACGGGTACCCCGGCATCACAGAGGAGCTGCTACGGA    120
       --A--L--A--Q--D--T--F--H--G--Y--P--G--I--T--E--E--L--L--R--S
121    GCCAGCTATATCCAGAGGTGCCACCCGAGGAGTTCCGCCCCTTTCTGGCAAAGATGAGGG    180
       --Q--L--Y--P--E--V--P--P--E--E--F--R--P--F--L--A--K--M--R--G
181    GGATTCTTAAGTCTATTGCGTCTGCAGACATGGATTTCAACCAGCTGGAGGCATTCTTGA    240
       --I--L--K--S--I--A--S--A--D--M--D--F--N--Q--L--E--A--F--L--T
241    CTGCTCAAACCAAAAAGCAAGGTGGGATCACATCTGACCAAGCTGCTGTCATTTCCAAAT    300
       --A--Q--T--K--K--Q--G--G--I--T--S--D--Q--A--A--V--I--S--K--F
301    TCTGGAAGAGCCACAAGACAAAAATCCGTGAGAGCCTCATGAACCAGAGCCGCTGGAATA    360
       --W--K--S--H--K--T--K--I--R--E--S--L--M--N--Q--S--R--W--N--S
361    GCGGGCTTCGGGGCCTGAGCTGGAGAGTTGATGGCAAGTCTCAGTCAAGGCACTCAGCTC    420
       --G--L--R--G--L--S--W--R--V--D--G--K--S--Q--S--R--H--S--A--Q
421    AAATACACACACCTGTTGCCATTATAGAGCTGGAATTAGGCAAATATGGACAGGAATCTG    480
       --I--H--T--P--V--A--I--I--E--L--E--L--G--K--Y--G--Q--E--S--E
481    AATTTCTGTGTTTGGAATTTGATGAGGTCAAAGTCAACCAAATTCTGAAGACGCTGTCAG    540
       --F--L--C--L--E--F--D--E--V--K--V--N--Q--I--L--K--T--L--S--E
541    AGGTAGAAGAAAGTATCAGCACACTGATCAGCCAGCCTAACTGAagatgatgtatgaagg    600
       --V--E--E--S--I--S--T--L--I--S--Q--P--N--***................
601    agttggagttgttgaaaccaaggtgtccatgatccctccccactgaccttttctaagaaa    660
       ............................................................
661    attcttgtgcccgcattggtattaaatcctcgcattcagtcttcctgcctctaaaaaaaa    720
       ............................................................
721    aaaaa                                                           780
       .....