Imprinted Gene Databases

Homo sapiens: CDKN1C

Cyclin-dependent kinase inhibitor 1C
Species Gene Aliases Location Status Expressed Allele
Mus musculus Cdkn1c CDKI, Kip2, p57Kip2, AL024410, p57(kip2)  7 69.49 cM  Imprinted Maternal
Macropus eugenii CDKN1C     Not Imprinted Biallelic
Homo sapiens CDKN1C BWS, WBS, p57, BWCR, KIP2  11p15.5  Imprinted Maternal
Ovis aries CDKN1C CDKN1C    Imprinted
1      agtgcgctgtgctcgaggggtgccggccaggcctgagcgagcgagctagccagcaggcat     60
       ............................................................
61     cgagggggcgcggctgccgtccggacgagacaggcgaacccgacgcagaagagtccacca    120
       ............................................................
121    ccggacagccaggtagccgccgcgtccctcgcacacgcagagtcgggcggcgcggggtct    180
       ............................................................
181    cccttgcgcccggcctccgccctctcctcctctcctttccccttcttctcgctgtcctct    240
       ............................................................
241    cctctctcgctgcccgcgtttgcgcagccccgggccATGTCCGACGCGTCCCTCCGCAGC    300
       ....................................M--S--D--A--S--L--R--S--
301    ACATCCACGATGGAGCGTCTTGTCGCCCGTGGGACCTTCCCAGTACTAGTGCGCACCAGC    360
       T--S--T--M--E--R--L--V--A--R--G--T--F--P--V--L--V--R--T--S--
361    GCCTGCCGCAGCCTCTTCGGGCCGGTGGACCACGAGGAGCTGAGCCGCGAGCTGCAGGCC    420
       A--C--R--S--L--F--G--P--V--D--H--E--E--L--S--R--E--L--Q--A--
421    CGCCTGGCCGAGCTGAACGCCGAGGACCAGAACCGCTGGGATTACGACTTCCAGCAGGAC    480
       R--L--A--E--L--N--A--E--D--Q--N--R--W--D--Y--D--F--Q--Q--D--
481    ATGCCGCTGCGGGGCCCTGGACGCCTGCAGTGGACCGAAGTGGACAGCGACTCGGTGCCC    540
       M--P--L--R--G--P--G--R--L--Q--W--T--E--V--D--S--D--S--V--P--
541    GCGTTCTACCGCGAGACGGTGCAGGTGGGGCGCTGCCGCCTGCTGCTGGCGCCGCGGCCC    600
       A--F--Y--R--E--T--V--Q--V--G--R--C--R--L--L--L--A--P--R--P--
601    GTCGCGGTCGCGGTGGCTGTCAGCCCGCCCCTCGAGCCGGCCGCTGAGTCCCTCGACGGC    660
       V--A--V--A--V--A--V--S--P--P--L--E--P--A--A--E--S--L--D--G--
661    CTCGAGGAGGCGCCGGAGCAGCTGCCTAGTGTCCCGGTCCCGGCCCCGGCGTCCACCCCG    720
       L--E--E--A--P--E--Q--L--P--S--V--P--V--P--A--P--A--S--T--P--
721    CCCCCAGTCCCGGTCCTGGCTCCAGCCCCGGCCCCGGCTCCGGCTCCGGTCGCGGCTCCG    780
       P--P--V--P--V--L--A--P--A--P--A--P--A--P--A--P--V--A--A--P--
781    GTCGCGGCTCCGGTCGCGGTCGCGGTCCTGGCCCCGGCCCCGGCCCCGGCTCCGGCTCCG    840
       V--A--A--P--V--A--V--A--V--L--A--P--A--P--A--P--A--P--A--P--
841    GCTCCGGCCCCGGCTCCAGTCGCGGCCCCGGCCCCAGCCCCGGCCCCGGCCCCGGCCCCG    900
       A--P--A--P--A--P--V--A--A--P--A--P--A--P--A--P--A--P--A--P--
901    GCCCCCGCCCCGGCCCCGGCCCCGGACGCGGCGCCTCAAGAGAGCGCCGAGCAGGGCGCG    960
       A--P--A--P--A--P--A--P--D--A--A--P--Q--E--S--A--E--Q--G--A--
961    AACCAGGGGCAGCGCGGCCAGGAGCCTCTCGCTGACCAGCTGCACTCGGGGATTTCGGGA   1020
       N--Q--G--Q--R--G--Q--E--P--L--A--D--Q--L--H--S--G--I--S--G--
1021   CGTCCCGCGGCCGGCACCGCGGCCGCCAGCGCCAACGGCGCGGCGATCAAGAAGCTGTCC   1080
       R--P--A--A--G--T--A--A--A--S--A--N--G--A--A--I--K--K--L--S--
1081   GGGCCTCTGATCTCCGATTTCTTCGCCAAGCGCAAGAGATCAGCGCCTGAGAAGTCGTCG   1140
       G--P--L--I--S--D--F--F--A--K--R--K--R--S--A--P--E--K--S--S--
1141   GGCGATGTCCCCGCGCCGTGTCCCTCTCCAAGCGCCGCCCCTGGCGTGGGCTCGGTGGAG   1200
       G--D--V--P--A--P--C--P--S--P--S--A--A--P--G--V--G--S--V--E--
1201   CAGACCCCGCGCAAGAGGCTGCGGTGAgccaatttagagcccaaagagccccgagggaac   1260
       Q--T--P--R--K--R--L--R--***.................................
1261   ctgccggggcagcggacgttggaagggcgctgggcctcggctgggaccgttcatgtagca   1320
       ............................................................
1321   gcaaccggcggcggctgccgcagagcagcgttcggttttgtttttaaattttgaaaactg   1380
       ............................................................
1381   tgcaatgtattaataacgtctttttatatctaaatgtattctgcacgagaaggtacactg   1440
       ............................................................
1441   gtcccaaggtgtaaagctttaagagtcatttatataaaatgtttaatctctgctgaaact   1500
       ............................................................
1501   cagtgcaaaaaaaagaaaaaagaaaaaaaaaaggaaaaaataaaaaaaccatgtatattt   1560
       ............................................................
1561   gtacaaaaagtttttaaagttatactaacttatattttctatttatgtccaggcgtggac   1620
       ............................................................
1621   cgctctgccacgcactagctcggttattggttatgccaaaggcactctccatctcccaca   1680
       ............................................................
1681   tctggttattgacaagtgtaactttattttcatcgcggactctggggaagggggtcactc   1740
       ............................................................
1741   acaagctgtagctgccatacatgcccatctagcttgcagtctcttcgcgctttcgctgtc   1800
       ............................................................
1801   tctcttattatgactgtgtttatctgaaacttgaagacaagtctgttaaaatggttcctg   1860
       ............................................................
1861   agccgtctgtaccactgccccggcccctcgtccgccgggttctaaataaagaggccgaaa   1920
       ............................................................
1921   aatgctgcaaaaaaaaaaaaaaa                                        1980
       .......................