Imprinted Gene Databases

Homo sapiens: CDKN1C

Cyclin-dependent kinase inhibitor 1C
Species Gene Aliases Location Status Expressed Allele
Homo sapiens CDKN1C BWS, WBS, p57, BWCR, KIP2  11p15.5  Imprinted Maternal
Macropus eugenii CDKN1C     Not Imprinted Biallelic
Ovis aries CDKN1C CDKN1C    Imprinted
Mus musculus Cdkn1c CDKI, Kip2, p57Kip2, AL024410, p57(kip2)  7 69.49 cM  Imprinted Maternal
1      agtgcgctgtgctcgaggggtgccggccaggcctgagcgagcgagctagccagcaggcat     60
       ............................................................
61     cgagggggcgcggctgccgtccggacgagacaggcgaacccgacgcagaagagtccacca    120
       ............................................................
121    ccggacagccaggtagccgccgcgtccctcgcacacgcagagtcgggcggcgcggggtct    180
       ............................................................
181    cccttgcgcccggcctccgccctctcctcctctcctttccccttcttctcgctgtcctct    240
       ............................................................
241    cctctctcgctgcccgcgtttgcgcagccccgggccATGTCCGACGCGTCCCTCCGCAGC    300
       ....................................M--S--D--A--S--L--R--S--
301    ACATCCACGATGGAGCGTCTTGTCGCCCGTGGGACCTTCCCAGTACTAGTGCGCACCAGC    360
       T--S--T--M--E--R--L--V--A--R--G--T--F--P--V--L--V--R--T--S--
361    GCCTGCCGCAGCCTCTTCGGGCCGGTGGACCACGAGGAGCTGAGCCGCGAGCTGCAGGCC    420
       A--C--R--S--L--F--G--P--V--D--H--E--E--L--S--R--E--L--Q--A--
421    CGCCTGGCCGAGCTGAACGCCGAGGACCAGAACCGCTGGGATTACGACTTCCAGCAGGAC    480
       R--L--A--E--L--N--A--E--D--Q--N--R--W--D--Y--D--F--Q--Q--D--
481    ATGCCGCTGCGGGGCCCTGGACGCCTGCAGTGGACCGAAGTGGACAGCGACTCGGTGCCC    540
       M--P--L--R--G--P--G--R--L--Q--W--T--E--V--D--S--D--S--V--P--
541    GCGTTCTACCGCGAGACGGTGCAGGTGGGGCGCTGCCGCCTGCTGCTGGCGCCGCGGCCC    600
       A--F--Y--R--E--T--V--Q--V--G--R--C--R--L--L--L--A--P--R--P--
601    GTCGCGGTCGCGGTGGCTGTCAGCCCGCCCCTCGAGCCGGCCGCTGAGTCCCTCGACGGC    660
       V--A--V--A--V--A--V--S--P--P--L--E--P--A--A--E--S--L--D--G--
661    CTCGAGGAGGCGCCGGAGCAGCTGCCTAGTGTCCCGGTCCCGGCCCCGGCGTCCACCCCG    720
       L--E--E--A--P--E--Q--L--P--S--V--P--V--P--A--P--A--S--T--P--
721    CCCCCAGTCCCGGTCCTGGCTCCAGCCCCGGCCCCGGCTCCGGCTCCGGTCGCGGCTCCG    780
       P--P--V--P--V--L--A--P--A--P--A--P--A--P--A--P--V--A--A--P--
781    GTCGCGGCTCCGGTCGCGGTCGCGGTCCTGGCCCCGGCCCCGGCCCCGGCTCCGGCTCCG    840
       V--A--A--P--V--A--V--A--V--L--A--P--A--P--A--P--A--P--A--P--
841    GCTCCGGCCCCGGCTCCAGTCGCGGCCCCGGCCCCAGCCCCGGCCCCGGCCCCGGCCCCG    900
       A--P--A--P--A--P--V--A--A--P--A--P--A--P--A--P--A--P--A--P--
901    GCCCCCGCCCCGGCCCCGGCCCCGGACGCGGCGCCTCAAGAGAGCGCCGAGCAGGGCGCG    960
       A--P--A--P--A--P--A--P--D--A--A--P--Q--E--S--A--E--Q--G--A--
961    AACCAGGGGCAGCGCGGCCAGGAGCCTCTCGCTGACCAGCTGCACTCGGGGATTTCGGGA   1020
       N--Q--G--Q--R--G--Q--E--P--L--A--D--Q--L--H--S--G--I--S--G--
1021   CGTCCCGCGGCCGGCACCGCGGCCGCCAGCGCCAACGGCGCGGCGATCAAGAAGCTGTCC   1080
       R--P--A--A--G--T--A--A--A--S--A--N--G--A--A--I--K--K--L--S--
1081   GGGCCTCTGATCTCCGATTTCTTCGCCAAGCGCAAGAGATCAGCGCCTGAGAAGTCGTCG   1140
       G--P--L--I--S--D--F--F--A--K--R--K--R--S--A--P--E--K--S--S--
1141   GGCGATGTCCCCGCGCCGTGTCCCTCTCCAAGCGCCGCCCCTGGCGTGGGCTCGGTGGAG   1200
       G--D--V--P--A--P--C--P--S--P--S--A--A--P--G--V--G--S--V--E--
1201   CAGACCCCGCGCAAGAGGCTGCGGTGAgccaatttagagcccaaagagccccgagggaac   1260
       Q--T--P--R--K--R--L--R--***.................................
1261   ctgccggggcagcggacgttggaagggcgctgggcctcggctgggaccgttcatgtagca   1320
       ............................................................
1321   gcaaccggcggcggctgccgcagagcagcgttcggttttgtttttaaattttgaaaactg   1380
       ............................................................
1381   tgcaatgtattaataacgtctttttatatctaaatgtattctgcacgagaaggtacactg   1440
       ............................................................
1441   gtcccaaggtgtaaagctttaagagtcatttatataaaatgtttaatctctgctgaaact   1500
       ............................................................
1501   cagtgcaaaaaaaagaaaaaagaaaaaaaaaaggaaaaaataaaaaaaccatgtatattt   1560
       ............................................................
1561   gtacaaaaagtttttaaagttatactaacttatattttctatttatgtccaggcgtggac   1620
       ............................................................
1621   cgctctgccacgcactagctcggttattggttatgccaaaggcactctccatctcccaca   1680
       ............................................................
1681   tctggttattgacaagtgtaactttattttcatcgcggactctggggaagggggtcactc   1740
       ............................................................
1741   acaagctgtagctgccatacatgcccatctagcttgcagtctcttcgcgctttcgctgtc   1800
       ............................................................
1801   tctcttattatgactgtgtttatctgaaacttgaagacaagtctgttaaaatggttcctg   1860
       ............................................................
1861   agccgtctgtaccactgccccggcccctcgtccgccgggttctaaataaagaggccgaaa   1920
       ............................................................
1921   aatgctgcaaaaaaaaaaaaaaa                                        1980
       .......................