Imprinted Gene Databases

Homo sapiens: C20orf82

Chromosome 20 open reading frame 82

Luedi et al. Genome Res. 17: , 2007 PDF; Luedi et al. Genome Res. 17: , 2007 Supplement

Species Gene Aliases Location Status Expressed Allele
Homo sapiens C20orf82 bA149I18.1, dJ1077I2.1  20p12.1  Predicted Paternal
Homo sapiens ISM1 ISM, Isthmin, C20orf82, bA149I18.1, dJ1077I2.1  20p12.1  Predicted Paternal
1      aaaaggATGGTGCGCCTGGCGGCCGAGCTGCTGCTGCTGCTGGGGCTGCTGCTGCTCACG     60
       ......M--V--R--L--A--A--E--L--L--L--L--L--G--L--L--L--L--T--
61     CTGCACATCACCGTGCTGCGCGGCTCGGGAGCCGCCGACGGGCCCGACGCGGCCGCGGGC    120
       L--H--I--T--V--L--R--G--S--G--A--A--D--G--P--D--A--A--A--G--
121    AACGCCAGCCAAGCCCAGCTGCAGAATAACCTCAACGTGGGAAGTGACACCACATCAGAA    180
       N--A--S--Q--A--Q--L--Q--N--N--L--N--V--G--S--D--T--T--S--E--
181    ACCAGCTTTTCTCTCTCCAAAGAAGCACCAAGGGAGCATCTGGACCACCAGGCTGCACAC    240
       T--S--F--S--L--S--K--E--A--P--R--E--H--L--D--H--Q--A--A--H--
241    CAACCCTTCCCCAGACCGCGATTCCGACAAGAGACGGGGCACCCTTCATTGCAAAGAGAT    300
       Q--P--F--P--R--P--R--F--R--Q--E--T--G--H--P--S--L--Q--R--D--
301    TTCCCCAGATCCTTTCTCCTTGATCTACCAAACTTTCCAGATCTTTCCAAAGCTGATATC    360
       F--P--R--S--F--L--L--D--L--P--N--F--P--D--L--S--K--A--D--I--
361    AATGGGCAGAATCCAAATATCCAGGTCACCATAGAGGTGGTCGACGGTCCTGACTCTGAA    420
       N--G--Q--N--P--N--I--Q--V--T--I--E--V--V--D--G--P--D--S--E--
421    GCAGATAAAGATCAGCATCCGGAGAATAAGCCCAGCTGGTCAGTCCCATCCCCCGACTGG    480
       A--D--K--D--Q--H--P--E--N--K--P--S--W--S--V--P--S--P--D--W--
481    CGGGCCTGGTGGCAGAGGTCCCTGTCCTTGGCCAGGGCAAACAGCGGGGACCAGGACTAC    540
       R--A--W--W--Q--R--S--L--S--L--A--R--A--N--S--G--D--Q--D--Y--
541    AAGTACGACAGTACCTCAGACGACAGCAACTTCCTCAACCCCCCCAGGGGGTGGGACCAT    600
       K--Y--D--S--T--S--D--D--S--N--F--L--N--P--P--R--G--W--D--H--
601    ACAGCCCCAGGCCACCGGACTTTTGAAACCAAAGATCAGCCAGAATATGATTCCACAGAT    660
       T--A--P--G--H--R--T--F--E--T--K--D--Q--P--E--Y--D--S--T--D--
661    GGCGAGGGTGACTGGAGTCTCTGGTCTGTCTGCAGCGTCACCTGCGGGAACGGCAACCAG    720
       G--E--G--D--W--S--L--W--S--V--C--S--V--T--C--G--N--G--N--Q--
721    AAACGGACCCGGTCTTGTGGCTACGCGTGCACTGCAACAGAATCGAGGACCTGTGACCGT    780
       K--R--T--R--S--C--G--Y--A--C--T--A--T--E--S--R--T--C--D--R--
781    CCAAACTGCCCAGGAATTGAAGACACTTTTAGGACAGCTGCCACCGAAGTGAGTCTGCTT    840
       P--N--C--P--G--I--E--D--T--F--R--T--A--A--T--E--V--S--L--L--
841    GCGGGAAGCGAGGAGTTTAATGCCACCAAACTGTTTGAAGTTGACACAGACAGCTGTGAG    900
       A--G--S--E--E--F--N--A--T--K--L--F--E--V--D--T--D--S--C--E--
901    CGCTGGATGAGCTGCAAAAGCGAGTTCTTAAAGAAGTACATGCACAAGGTGATGAATGAC    960
       R--W--M--S--C--K--S--E--F--L--K--K--Y--M--H--K--V--M--N--D--
961    CTGCCCAGCTGCCCCTGCTCCTACCCCACTGAGGTGGCCTACAGCACGGCCGACATCTTC   1020
       L--P--S--C--P--C--S--Y--P--T--E--V--A--Y--S--T--A--D--I--F--
1021   GACCGCATCAAGCGCAAGGACTTCCGCTGGAAGGACGCCAGCGGGCCCAAGGAGAAGCTG   1080
       D--R--I--K--R--K--D--F--R--W--K--D--A--S--G--P--K--E--K--L--
1081   GAGATCTACAAGCCCACTGCCCGGTACTGCATCCGCTCCATGCTGTCCCTGGAGAGCACC   1140
       E--I--Y--K--P--T--A--R--Y--C--I--R--S--M--L--S--L--E--S--T--
1141   ACGCTGGCGGCACAGCACTGCTGCTACGGCGACAACATGCAGCTCATCACCAGGGGCAAG   1200
       T--L--A--A--Q--H--C--C--Y--G--D--N--M--Q--L--I--T--R--G--K--
1201   GGGGCGGGCACGCCCAACCTCATCAGCACCGAGTTCTCCGCGGAGCTCCACTACAAGGTG   1260
       G--A--G--T--P--N--L--I--S--T--E--F--S--A--E--L--H--Y--K--V--
1261   GACGTCCTGCCCTGGATTATCTGCAAGGGTGACTGGAGCAGGTATAACGAGGCCCGGCCT   1320
       D--V--L--P--W--I--I--C--K--G--D--W--S--R--Y--N--E--A--R--P--
1321   CCCAACAACGGACAGAAGTGCACAGAGAGCCCCTCGGACGAGGACTACATCAAGCAGTTC   1380
       P--N--N--G--Q--K--C--T--E--S--P--S--D--E--D--Y--I--K--Q--F--
1381   CAAGAGGCCAGGGAATATTAAagagactgggatgaggtggaggacgctgcctctggttct   1440
       Q--E--A--R--E--Y--***.......................................
1441   ggagcacacacgtgctgcactgacgtgccgactggcgccgagaccttcatagctgcggtc   1500
       ............................................................
1501   gtgtatatttgtatataccacatgagtatttctcatacattacgctaggggcgtgtgcca   1560
       ............................................................
1561   cgcccaggggactgccttgtgaagccgccctcgccatctgcagagctccttgaaagtgcc   1620
       ............................................................
1621   cctggggagcgatgtgggcagaaggatggggacaacttggaagccagaagaagaacctgg   1680
       ............................................................
1681   aagccacagtgggtgcgactcaattcacacccggatccagagtttcaaagagaggcaaag   1740
       ............................................................
1741   ggggaaagagactgaggttgtaaacgttataagcagtttttatatataacttatttaata   1800
       ............................................................
1801   caaatgtgacttaattaagcgtaaccttttctctggagttgtggtgaaactaatcacgtc   1860
       ............................................................
1861   tgtgagagatcagaaagaaagagacttagggaagtggaagagaaagggaattttggaatt   1920
       ............................................................
1921   tatttctttaaaaataatgcaatggaaatatatcaaaacatgtaaacgcccaccttaaac   1980
       ............................................................
1981   caaatgttatttggtcatgaggcaccttgctggagtctcagattccaaaagtctcttctt   2040
       ............................................................
2041   cagactgggtagggaatatgatattttagggacaaagctgaggactggttttaaataggc   2100
       ............................................................
2101   tttaaaataaaagatcaatattatcataatgctatcattctgctaaacggccccaaaaca   2160
       ............................................................
2161   gtagaatttctgctcatgtcctagcaggttcagaagactgcagccaagttcagatgtaaa   2220
       ............................................................
2221   aacaagaagtagcacttttccaaaggaaaacaacaaaacaaatgggaaaaagataatgga   2280
       ............................................................
2281   ccgcatttcacctattttaatactattttaacaattttttcatctaccaatatatcccca   2340
       ............................................................
2341   ataaataaatataaaagggggggagggtcaatctggggaatcttagttttttatgtttta   2400
       ............................................................
2401   agaaaacaaaaaaaactgcattatttttgtaaagtatttattgagtcacggattattgtg   2460
       ............................................................
2461   catcaagcaattgttaatatgacctggtcctatggggtagaacttaggaaaaataaagtt   2520
       ............................................................
2521   ggttcttattcaatattttactttgcaaaattctagtaaaagagagtatataataaaatc   2580
       ............................................................
2581   ataataaaaggtaaaaaaaaaaaaaaaaaa                                 2640
       ..............................